Check patentability & draft patents in minutes with Patsnap Eureka AI!

Universal PCR primer combination for detecting chimeric antigen receptor genes, and application thereof

A chimeric antigen receptor and primer combination technology, applied in the field of T cell immunotherapy, can solve the problems of low sensitivity, high detection results, and low affinity, and achieve the effects of good specificity, high accuracy, and high sensitivity

Inactive Publication Date: 2019-05-07
BIORAY LABORATORIES INC
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection of CD19 CAR by mouse monoclonal antibody (clone number 136.20.1) relies on the binding of the monoclonal antibody to the scFv on CD19 CAR. There is a defect of low sensitivity
In addition, in the course of the experiment, it was found that when the viral vector transfers RNA to T cells, some genes begin to be expressed when they are not integrated into the genome, and the CD19 antigen receptor is expressed on the T cell, and the CD19 antigen binds to the CD19 antigen receptor The result of the test is too high, which cannot correctly reflect the number of CAR-positive T cells with autonomous replication function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Universal PCR primer combination for detecting chimeric antigen receptor genes, and application thereof
  • Universal PCR primer combination for detecting chimeric antigen receptor genes, and application thereof
  • Universal PCR primer combination for detecting chimeric antigen receptor genes, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1. Detection of the copy number of the chimeric antigen receptor gene in cells by real-time fluorescent quantitative PCR

[0037] 1. Fluorescence quantitative PCR primer and probe design

[0038] According to the gene sequence of the costimulatory signaling molecule ligand CD3ζ on different chimeric antigen receptors, the sequence of the internal reference gene Actin was retrieved at the same time, and after bioinformatics comparison and analysis, a highly conserved and specific region was found. The sequence is as follows:

[0039] Costimulatory signal molecule ligand CD3ζ specific sequence (5'-3'):

[0040] TGTCACTGGTTATCACCCTTTACTGCAAACGGGGCAGAAAGAAACTCCTGTATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGC (SEQ ID No. 7);

[0041] Internal reference gene Actin specific sequence (5'-3'):

[0042] GCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCG...

Embodiment 2

[0074] Example 2, Real-time fluorescent quantitative PCR detection performance of chimeric antigen receptor gene copy number

[0075] 1. Specific detection

[0076] According to the method of Example 1, the two sets of primers and probes shown in Table 1 were used to amplify the DNA samples shown in Table 3, and the results are shown in Table 3. The results show that each primer-probe shown in Table 1 has specific amplification only to the template of the chimeric antigen receptor gene containing co-stimulatory signaling molecule ligand CDCD3ζ, indicating that the designed primers and probes have good specificity. sex.

[0077] Table 3. Specificity detection results

[0078]

[0079] 2. Sensitivity detection

[0080] Test one,

[0081]Template: Different concentrations of dilutions of the standard plasmid A (containing the CD19 chimeric antigen receptor (also containing the co-stimulatory signaling molecule ligand CD3ζ) gene) in step 3 of Example 1 (concentrations are 5...

Embodiment 3

[0099] Embodiment 3, real-time fluorescent quantitative PCR detects different samples

[0100] The primers and probes in Table 1 in Example 1 were used to detect different samples, and the amplification results were separated by gel electrophoresis and sequenced, and the sequencing results were retrieved. The results are shown in Table 6.

[0101] Table 6. The results of testing different samples

[0102]

[0103]

[0104] The results in Table 6 show that the primers and probes in Table 1 can accurately detect the co-stimulatory signaling molecule ligand CD3ζ on the BCMA chimeric antigen receptor gene and CD19 chimeric antigen receptor gene.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Average molecular weightaaaaaaaaaa
Average molecular weightaaaaaaaaaa
Copy numberaaaaaaaaaa
Login to View More

Abstract

The present application discloses a universal PCR primer combination for detecting chimeric antigen receptor genes, and an application thereof. The primer combination comprises a primer pair for specifically detecting the chimeric antigen receptor genes, sequences of the primer pair are shown in SEQ ID No.1-2, chimeric antigen receptors comprise a costimulatory signal molecule ligand CD3-zeta, anda target of the primer pair is located on a coding gene of the costimulatory signal molecule ligand CD3-zeta. The primer pair provided by the present application has advantages of good specificity, high sensitivity and high accuracy, can be widely applied to qualitative and quantitative detections of one or more of the chimeric antigen receptor genes, and has important application values in the fields of T cell immunotherapy of CAR-T cell quality control, companion diagnostics and detection of CAR-T in blood during a treatment process of clinical patients using one or more of the CAR-T, etc.

Description

technical field [0001] The invention relates to the field of T cell immunotherapy, in particular to a general-purpose PCR primer combination and application for detecting chimeric antigen receptor genes. Background technique [0002] Chimeric antigen receptor T cell immunotherapy (CAR-T) cell is a kind of T cell with chimeric antigen receptor. Through genetic modification, T lymphocytes express specific CAR. CAR is mainly composed of antigen binding region outside the cell membrane and cell membrane The inner signal transduction region is composed of a hinge region and a transmembrane region. [0003] At present, the design of CAR in CAR-T cells has developed from the first-generation CAR that only contains a single CD3ζ signaling domain to the second-generation CAR that incorporates co-stimulatory molecular signaling domains such as CD28 and CD137 (4-1BB). The third generation CAR. It is well known that the complete activation of T cells requires the first signal from the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/686
Inventor 孙耀光暴佳芳姚连琦张亮席在喜
Owner BIORAY LABORATORIES INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More