Unlock instant, AI-driven research and patent intelligence for your innovation.
SgRNA for targeting TCR and B2M and guiding Cas9 protein to efficiently cut TCR and B2M gene locus
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A targeting and cell technology, applied in the field of nucleotide sequences with nuclease-guided function, can solve the problems of mutual sequence interference, low efficiency of multi-gene knockout and low cutting efficiency.
Active Publication Date: 2019-05-14
BIORAY LABORATORIES INC
View PDF6 Cites 9 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, there are still the following problems: 1. The existing guide sgRNA sequence still has a certain off-target risk; 2. The efficiency of cutting the target gene sequence mediated by the existing guide sgRNA sequence is low; will interfere with each other
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0158] Example 1 sgRNA screening design
[0159] 1 Design of sgRNA
[0160] The recognition region sequence and full-length sequence of each sgRNA sequence are shown in Table 1. The target sequence corresponding to the recognition region sequence of each sgRNA sequence is to replace "U" in the recognition region sequence with "T".
[0161] An oligo corresponding to the corresponding sgRNA was synthesized, annealed, and then ligated into the PX458 vector.
[0162] Some representative oligo sequences are shown below, and oligos corresponding to other sgRNAs can be prepared in the same way.
[0163] oligos for TRBC1-sgRNA1:
[0164] TRBC1-sgRNA1-oligo-F:CACCGAGCTCAGCTCCACGTGGTC (SEQ ID No.:70)
[0165]TRBC1-sgRNA1-oligo-R:AAACGACCACGTGGAGCTGAGCTC (SEQ ID No.:71)
[0167] TRBC1-luci-Donor-F:ATCCTGGCTCCAACCCCTCTTC (SEQ ID No.: 72)
[0168] TRBC1-luci-Donor-R:ATCTGTCTGCTACCTGGATCTTTC (SEQ ID No.: 73)
[0169] 2 Screening of targets
...
Embodiment 2
[0183] Example 2 sgRNA T7-oligo fragment design
[0184] Design the sgRNA targeting the α chain, β1 chain, β2 chain and B2M of TCR, and replace the following 18 Ns with the target sequence targeted by the sgRNA.
[0185] TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNN GTTTTAGAGCTAGAAAT (SEQ ID No.: 69)
[0186] After the sgRNA T7-oligo is synthesized, according to the synthesis feedback information, dilute it with RNase free water to 100 μM mother solution, and then store it in a -20°C refrigerator for later use.
Embodiment 3
[0187] Example 3 Overlap PCR to prepare sgRNA precursor
[0188] The kit is ToYoBo High FideliUUy DNApolymerase KOD-Plus-
[0189] The liquid primer was diluted ten times as a template, and the system was as follows:
[0193] Set up 2 multiple tubes for each target, take out 5ul samples after PCR, and check whether the brightness of the band is single by agarosegel electrophoresis.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides sgRNA for targeting TCR and B2M and guiding Cas9 protein to efficiently cut a TCR and B2M gene locus, and particularly provides a reagent for preparing general CAR-T cells, thesgRNA for targeting the TCR and / or B2M or an expression carrier for expressing the sgRNA. By means of the sgRNA, TCR and B2M genes can be efficiently, peculiarly and stably knocked out in off-target-uneasy and non-mutual-interference modes, and therefore the gene knockout efficiency is greatly improved. In addition, the invention provides a general CAR-T cell modified by the sgRNA. By means of thesgRNA, graft-versus-host disease and immunological rejection risk can be effectively reduced.
Description
technical field [0001] The invention relates to the field of biotechnology, in particular to a nucleotide sequence with nuclease guiding function. Background technique [0002] Chimeric Antigen Receptor T-Cell (CAR-T) technology is currently one of the more effective treatments for malignant tumors. The basic principle of the technology is to extract T cells from the patient and culture them in vitro. During the cultivation process, the patient's own T cells are allowed to express specific tumor antigen receptors by using genetic engineering methods. After recognizing tumor-associated antigens or tumor-specific antigens, T cells can be efficiently activated and proliferate in large numbers, releasing anti-tumor agents. active molecules, thereby exerting a potent tumor-killing effect. After the modified T cells proliferate in large quantities in vitro, CAR-T will be injected back into the patient to attackcancer cells expressing specific antigens. CAR-T therapy has achiev...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More