Lentivirus for specifically inhibiting DCUN1D1 gene and construction method and application thereof
A construction method and lentiviral technology, applied in the fields of molecular biology and oncology, can solve the problems of unknown protein expression, function and mechanism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0079] A method for constructing a lentivirus that specifically inhibits DCUN1D1 gene expression, comprising the steps of:
[0080] (1) Using the NCBI (https: / / www.ncbi.nlm.nih.gov / gene) database, obtain the coding (CDS) region sequence of the human DCUN1D1 gene, and mark its start codon coding sequence (ATG) and termination Codon coding sequence (TAG):
[0081] ATG ATCTTCACACAATCTAGTGAAAAAACAGCAGTAAGTTGTCTTTCTCAAAATGACTGGAAGTTAGATGTTGCAACAGATAATTTTTTCCAAAATCCTGAACTTTATATACGAGAGAGTGTAAAAGGATCATTGGACAGGAAGAAGTTAGAACAGCTGTACAATAGATACAAAGACCCTCAAGATGAGAATAAAATTGGAATAGATGGCATACAGCAGTTCTGTGATGACCTGGCACTCGATCCAGCCAGCATTAGTGTGTTGATTATTGCGTGGAAGTTCAGAGCAGCAACACAGTGCGAGTTCTCCAAACAGGAGTTCATGGATGGCATGACAGAATTAGGATGTGACAGCATAGAAAAACTAAAGGCCCAGATACCCAAGATGGAACAAGAATTGAAAGAACCAGGACGATTTAAGGATTTTTACCAGTTTACTTTTAATTTTGCAAAGAATCCAGGACAAAAAGGATTAGATCTAGAAATGGCCATTGCCTACTGGAACTTAGTGCTTAATGGAAGATTTAAATTCTTAGACTTATGGAATAAATTTTTGTTGGAACATCATAAACGATCAATACCAAAAGACACTTGGAATCTTCTTTTAGACTTCAGTACGATGATT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



