Supercharge Your Innovation With Domain-Expert AI Agents!

SSR reagent kit capable of rapidly identifying opium poppy

A kit and poppy technology, applied in the field of SSR kits for rapid identification of poppies, can solve problems such as the difficulty of detecting similar poppies, achieve rapid and reliable identification, high specificity, and avoid interference

Active Publication Date: 2019-07-12
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The similarity of phenotypes between closely related species brings difficulties to the identification of opium poppy and the detection of related cases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SSR reagent kit capable of rapidly identifying opium poppy
  • SSR reagent kit capable of rapidly identifying opium poppy
  • SSR reagent kit capable of rapidly identifying opium poppy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Screening and optimization of SSR-specific molecular markers for poppy identification

[0063] 1. The applicant downloads the poppy genome and the entire EST sequence from NCBI, excavates the SSR sites of different repeating units, and designs primers; uses the designed and synthesized primers to perform PCR amplification on poppy and its close relative species, and the amplification is stable and specific Sites with strong specificity, fragment size between 100-350bp and fragment size difference of 20-60bp constitute a specific primer set; fluorescently labeled M13 adapters are used in PCR amplification to effectively reduce costs.

[0064] The sequence of the specific primer set obtained by screening is:

[0065] M13: GTAAAACGACGGCCAGT;

[0066] P1F: GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC;

[0067] P1R: CTCTGCACGATGAAGCTGAC;

[0068] P2F: GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC;

[0069] P2R: AATCCTCGGCTGAGCTTACA;

[0070] P3F: GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC;...

Embodiment 2

[0076] Application of SSR Specific Primer Set in Poppy Species Species Identification

[0077] 1. Collection of plant samples of opium poppy and its related species

[0078] On the intraspecies level, opium poppy samples were provided by Wuhan Botanical Garden of the Chinese Academy of Sciences, the First Research Institute of the Ministry of Public Security and other relevant units. The origins are: Wuhan, Hubei, Duerbert Mongolian Autonomous County, Heilongjiang, Heze, Shandong, Changqing, Shandong, and Myanmar; At the same time, the collected poppy samples included individuals with variations in flower color (red, pink, purple, white, etc.), flower shape (single and double) and number of pods (single and multiple).

[0079] At the interspecific level within the genus, samples of 7 species and 2 variants of the genus Papaver were collected, and each species collected as many individuals as possible from different populations in its distribution area.

[0080] At the intra-f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SSR reagent kit capable of rapidly identifying opium poppy, and relates to the technical field of molecule identification. The SSR reagent kit comprises a set of molecular markers for detecting opium poppy and close species thereof, a PCR amplification reagent and a capillary electrophoresis detection reagent. The set of molecular markers for detecting opium poppy and close species thereof comprise an M13 public fluorescent primer and three specific primer sets; the PCR amplification reagent comprises 2*Taq PCR Master Mix and ddH2O; the PCR amplification reagent includes HI-DI FORMAMIDE BOTTLE and LIZ500. The reagent kit is used for identifying opium poppy homogeneity, siblings, siblings and other species of plants. Compared with the prior art, the higher speciesspecificity and the higher accuracy are achieved for identifying opium poppy and close species plants thereof.

Description

technical field [0001] The invention relates to the technical field of molecular identification, in particular to an SSR kit for rapidly identifying poppy. Background technique [0002] Poppy (Papaver somniferum L.) is an annual herb plant of the genus Papaver (Papaver L.) in the family Papaveraceae (Papaveraceae). It is the main raw material for making opium. Its extracts are morphine, thebaine, codeine, papaverine and Source of various sedatives such as codin. Along with marijuana and coca, opium poppy is listed as the world's three major drug original plants by the United Nations Convention against Narcotics. There are about 100 species of poppy, which are mainly produced in central and southern Europe to temperate Asia, and a few species are produced in America, Oceania and southern Africa. There are 7 species of 3 varieties and 3 varieties in my country, namely poppy (P.somniferum L.), ghost poppy (Papaver orientale L.), poppy (Papaver rhhoeas L.), black ring poppy (P...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156C12Q2600/13
Inventor 梁琼杨路路张燕君袁芳
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More