Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker for identifying sphyraena pinguis gunther from sphyraena putnamae and application of molecular marker

A molecular marker, inverted tooth sting technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Avoid economic losses, high efficiency

Inactive Publication Date: 2019-07-19
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the above problems, the object of the present invention is to provide a molecular marker primer and its application for distinguishing the genus of chrysalis and the genus of chrysalis, which helps to solve the problem of mixed germplasm of fishes of the genus genus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for identifying sphyraena pinguis gunther from sphyraena putnamae and application of molecular marker
  • Molecular marker for identifying sphyraena pinguis gunther from sphyraena putnamae and application of molecular marker
  • Molecular marker for identifying sphyraena pinguis gunther from sphyraena putnamae and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] A molecular marker primer and its identification method for distinguishing oily beetle and mandarin beetle:

[0027] 1) The sample populations were selected from the species of the basilisk and the invertebrate collected in the Beibu Gulf, and the DNA of the two sample populations were extracted respectively;

[0028] 2) using the DNA extracted in step 1) as a template, and amplifying through the PCR reaction system with primer F and primer R respectively;

[0029] The composition of described PCR reaction system is:

[0030] Add in order to the 0.2ml centrifuge tube:

[0031]

[0032] The PCR amplification program was pre-denaturation at 94°C for 2 min, (denaturation at 94°C for 15 sec, annealing at 50°C for 15 sec, extension at 72°C for 15 sec) x 38 cycles, extension at 72°C for 3 min, and storage at 4°C for long-term storage.

[0033] 3) Purify and sequence the PCR products, and compare the sequencing results of the two populations to identify their species.

Embodiment 2

[0035] A molecular marker primer and its identification method for distinguishing oily beetle and mandarin beetle:

[0036] 1) The sample populations were selected from the species of the basilisk and the invertebrate collected in the Beibu Gulf, and the DNA of the two sample populations were extracted respectively;

[0037] 2) using the DNA extracted in step 1) as a template, and amplifying through the PCR reaction system with primer F and primer R respectively;

[0038] The composition of described PCR reaction system is:

[0039] Add in order to the 0.2ml centrifuge tube:

[0040]

[0041]

[0042] The PCR amplification program was pre-denaturation at 94°C for 4 min, (denaturation at 94°C for 35 sec, annealing at 53°C for 30 sec, extension at 72°C for 15 sec) x 30 cycles, extension at 72°C for 10 min, and storage at 4°C for long-term storage.

[0043] 3) Purify and sequence the PCR products, and compare the sequencing results of the two populations to identify their...

Embodiment 3

[0045] A molecular marker primer and its identification method for distinguishing oily beetle and mandarin beetle:

[0046] 1) The sample populations were selected from the species of the basilisk and the invertebrate collected in the Beibu Gulf, and the DNA of the two sample populations were extracted respectively;

[0047] 2) using the DNA extracted in step 1) as a template, and amplifying through the PCR reaction system with primer F and primer R respectively;

[0048] The composition of described PCR reaction system is:

[0049] Add in order to the 0.2ml centrifuge tube:

[0050]

[0051] The PCR amplification program was pre-denaturation at 94°C for 5 min, (denaturation at 94°C for 35 sec, annealing at 50°C for 35 sec, extension at 72°C for 35 sec) x 38 cycles, extension at 72°C for 10 min, and storage at 4°C for long-term storage.

[0052] 3) Purify and sequence the PCR products, and compare the sequencing results of the two populations to identify their species.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims to provide molecular marker for identifying sphyraena pinguis gunther from sphyraena putnamae and an application of the molecular marker to solve the problem that germplasms of sphyraena fishes are mixed. The molecular marker for identifying the sphyraena pinguis gunther from the sphyraena putnamae comprises a primer F and a primer R respectively, wherein primer sequences are asfollows: the primer F: TCAACCAACCACAAAGACATT; the primer R: ATTATTAGGGGGATGAGTCAGTT; and the molecular marking primers are applied to identification of the sphyraena pinguis gunther from the sphyraena putnamae. Results of the molecular marking sequences indicate that the two fishes have difference of 35 basic groups including 25 conversions and 10 transversions, the results are stable and the repeatability is high. The method is simple to operate, easy to master and high in accuracy.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker primer and an application thereof for discriminating oil-drilled and invertebrates. Background technique [0002] The oily fish and the invertebrate, both belonging to the order Perciformes, the family of the family, and the genus, are widely distributed in the Indian Ocean and the Pacific Ocean, and are the most common in the South my country Sea. The two kinds of fish are delicate and delicious, and have high edible value. Important marine fishing in the province. External features are: body shape is fusiform, with long tip; upper part of body side is dark brown; lower part is grayish white; mouth is large, upper jaw is composed of premaxillary bone; Regression; body covered with round scales. The lateral line is well developed and straight; the pectoral fin is in the middle position; the caudal fin is forked. Both kinds of fish are in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156
Inventor 单斌斌孙典荣刘岩杨长平赵雨
Owner SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI