Method for inserting turnip mosaic virus (TuMV) P3 protein into labels and recombinant vector and application of (TuMV) P3 protein

A technology of turnip mosaic virus and recombinant vector, applied in the field of genetic engineering, can solve the problems of not necessarily coincident distribution of expression levels, complex interaction of virus proteins, etc.

Active Publication Date: 2019-08-16
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the following problems exist in the study of viral protein functions based on the 35S promoter expression vector: (1) The 35S promoter is the promoter of cauliflower mosaic virus, which has high expression activity, resulting in high expression of the target protein in the cell and the formation of aggregates , does not present the true subcellular localization and expression of viral proteins; (2) There is a complex interaction between viral proteins. The level and the distribution in the cells are not necessarily consistent, which will produce false impressions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inserting turnip mosaic virus (TuMV) P3 protein into labels and recombinant vector and application of (TuMV) P3 protein
  • Method for inserting turnip mosaic virus (TuMV) P3 protein into labels and recombinant vector and application of (TuMV) P3 protein
  • Method for inserting turnip mosaic virus (TuMV) P3 protein into labels and recombinant vector and application of (TuMV) P3 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Such as figure 1 Shown is a method for inserting tags into the P3 protein of TUMOV, inserting Myc into the N-terminus of pCambia2300-TuMV P3 protein. Specifically include the following steps:

[0053] (1) Use TuMV-KpnI-F and Hcpro-2a-Myc-P3-R as primers, and use the plasmid containing the TuMV sequence as a template to amplify the first specific PCR band by PCR with high-fidelity DNA polymerase , and recover a specific PCR band, called PCR1;

[0054] TuMV-KpnI-F: tacgagacaagagc ggtacc aaatgggtcacggaaac,

[0055] TuMV-SnaBI-R: aagacatactac tacgta atctattacctatac, as shown in SEQ ID: No.3-4;

[0056] (2) Using Hcpro-2A-Myc-P3-F and TuMV-SnaBI-R as primers, and using the plasmid containing the TuMV sequence as a template, high-fidelity DNA polymerase was used to amplify the second specific PCR band by PCR , and recover a specific PCR band, called PCR2;

[0057] Hcpro-2A-Myc-P3-F:acactaccgcgttggaggaacagagcagaagctgatctcagaggaggacctgggaacagaatgggaggac,

[0058] Hcpr...

Embodiment 2

[0065] Such as figure 1 Shown is a method for inserting tags into the P3 protein of TUMOV, inserting Myc-GFP into the N-terminus of the pCambia2300-TuMV P3 protein. Specifically include the following steps:

[0066] (1) Using TuMV-KpnI-F and GFP-Myc-Hc-R as primers, using a plasmid containing the TuMV sequence as a template, using a high-fidelity DNA polymerase to perform PCR amplification to obtain the first specific PCR band, and Recover a specific PCR band, called PCR1;

[0067] TuMV-KpnI-F: tacgagacaagagc ggtacc aaatgggtcacggaaac,

[0068] GFP-Myc-Hc-R: aagttcttctcctttactcaggtcctcctctgagatcagcttctgctctgttcctccaacgcggta, as shown in SEQ ID: No.3 and No.8;

[0069] (2) Use Hc-Myc-GFP-F and P3-2A-GFP-R as primers, and use the plasmid containing the GFP sequence as the template, and use high-fidelity DNA polymerase to perform PCR to amplify the second specific PCR band , and recover a specific PCR band, called PCR2;

[0070] Hc-Myc-GFP-F: taccgcgttggaggaacagagcagaagctga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inserting turnip mosaic virus (TuMV) P3 protein into labels and a recombinant vector and application of the TuMV P3 protein. In the method, an Myc label and an Myc-GFP label are inserted into the N-terminal of P3 position in TuMV infected clone pCambia2300-TuMV, and Myc-P3 protein and Myc-GFP-P3 protein with the labels can be expressed; the constructed recombinant vectors pCambia2300-TuMV:Myc-P3 and pCambia2300-TuMV:Myc-GFP-P3 have the characteristics and advantages of infectivity, and the inserted labels do not affect the infectivity of the TuMV; the vectors can express specific label fusion protein and can be used for subsequent analyse of TuMV P3 protein; due to high expression of the fusion protein, P3 is proved to be the important functional gene of the TuMV, immunoprecipitation can be carried out by label antibody, and host proteins interacting with P3 are screened out; the P3 protein inserted into GFP fluorescence labels, and the real function of the TuMV P3 protein infected by virus can be observed.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for inserting tags into the P3 protein of turnip mosaic virus and a constructed recombinant vector. Background technique [0002] Turnip mosaic virus (TuMV) is a single-stranded, positive-sense plant RNA virus belonging to the family Potatoviridae. TuMV can infect a variety of vegetable crops and oilseed crops of the Cruciferae family, and is an important pathogen in agricultural production in my country and the world. The general research on the function of plant viral protein is to use the transient expression vector based on 35S promoter to analyze the subcellular localization, protein expression and other functions of viral protein. However, the following problems exist in the study of viral protein functions based on the 35S promoter expression vector: (1) The 35S promoter is the promoter of cauliflower mosaic virus, which has high expression activity, resulting ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/65C12N15/40C07K14/08G01N33/569
CPCC07K14/005C12N15/65C12N15/8205C12N2770/34022G01N33/56983
Inventor李方方周雪平张明振
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI