Unlock instant, AI-driven research and patent intelligence for your innovation.
Method for inserting turnip mosaic virus (TuMV) P3 protein into labels and recombinant vector and application of (TuMV) P3 protein
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of turnip mosaic virus and recombinant vector, applied in the field of genetic engineering, can solve the problems of not necessarily coincident distribution of expression levels, complex interaction of virus proteins, etc.
Active Publication Date: 2019-08-16
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the following problems exist in the study of viral protein functions based on the 35S promoter expression vector: (1) The 35S promoter is the promoter of cauliflower mosaic virus, which has high expression activity, resulting in high expression of the target protein in the cell and the formation of aggregates , does not present the true subcellular localization and expression of viral proteins; (2) There is a complex interaction between viral proteins. The level and the distribution in the cells are not necessarily consistent, which will produce false impressions
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0052] Such as figure 1 Shown is a method for inserting tags into the P3 protein of TUMOV, inserting Myc into the N-terminus of pCambia2300-TuMV P3 protein. Specifically include the following steps:
[0053] (1) Use TuMV-KpnI-F and Hcpro-2a-Myc-P3-R as primers, and use the plasmid containing the TuMV sequence as a template to amplify the first specific PCR band by PCR with high-fidelity DNApolymerase , and recover a specific PCR band, called PCR1;
[0055] TuMV-SnaBI-R: aagacatactac tacgta atctattacctatac, as shown in SEQ ID: No.3-4;
[0056] (2) Using Hcpro-2A-Myc-P3-F and TuMV-SnaBI-R as primers, and using the plasmid containing the TuMV sequence as a template, high-fidelity DNApolymerase was used to amplify the second specific PCR band by PCR , and recover a specific PCR band, called PCR2;
[0065] Such as figure 1 Shown is a method for inserting tags into the P3 protein of TUMOV, inserting Myc-GFP into the N-terminus of the pCambia2300-TuMV P3 protein. Specifically include the following steps:
[0066] (1) Using TuMV-KpnI-F and GFP-Myc-Hc-R as primers, using a plasmid containing the TuMV sequence as a template, using a high-fidelity DNApolymerase to perform PCR amplification to obtain the first specific PCR band, and Recover a specific PCR band, called PCR1;
[0068] GFP-Myc-Hc-R: aagttcttctcctttactcaggtcctcctctgagatcagcttctgctctgttcctccaacgcggta, as shown in SEQ ID: No.3 and No.8;
[0069] (2) Use Hc-Myc-GFP-F and P3-2A-GFP-R as primers, and use the plasmid containing the GFP sequence as the template, and use high-fidelity DNA polymerase to perform PCR to amplify the second specific PCR band , and recover a specific PCR band, called PCR2;
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a method for inserting turnip mosaic virus (TuMV) P3 protein into labels and a recombinant vector and application of the TuMV P3 protein. In the method, an Myc label and an Myc-GFP label are inserted into the N-terminal of P3 position in TuMV infected clone pCambia2300-TuMV, and Myc-P3 protein and Myc-GFP-P3 protein with the labels can be expressed; the constructed recombinant vectors pCambia2300-TuMV:Myc-P3 and pCambia2300-TuMV:Myc-GFP-P3 have the characteristics and advantages of infectivity, and the inserted labels do not affect the infectivity of the TuMV; the vectors can express specific labelfusion protein and can be used for subsequent analyse of TuMV P3 protein; due to high expression of the fusion protein, P3 is proved to be the important functional gene of the TuMV, immunoprecipitation can be carried out by label antibody, and host proteins interacting with P3 are screened out; the P3 protein inserted into GFP fluorescence labels, and the real function of the TuMV P3 protein infected by virus can be observed.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
