Method for inserting tag into turnip mosaic virus p3 protein and its recombinant vector and application

A turnip mosaic virus and recombinant vector technology, applied in the field of genetic engineering, can solve problems such as the distribution of expression levels not necessarily matching, the complex interaction of viral proteins, etc.

Active Publication Date: 2021-02-09
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the following problems exist in the study of viral protein functions based on the 35S promoter expression vector: (1) The 35S promoter is the promoter of cauliflower mosaic virus, which has high expression activity, resulting in high expression of the target protein in the cell and the formation of aggregates , does not present the true subcellular localization and expression of viral proteins; (2) There is a complex interaction between viral proteins. The level and the distribution in the cells are not necessarily consistent, which will produce false impressions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inserting tag into turnip mosaic virus p3 protein and its recombinant vector and application
  • Method for inserting tag into turnip mosaic virus p3 protein and its recombinant vector and application
  • Method for inserting tag into turnip mosaic virus p3 protein and its recombinant vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Such as figure 1 Shown is a method for inserting tags into the P3 protein of TUMOV, inserting Myc into the N-terminus of pCambia2300-TuMV P3 protein. Specifically include the following steps:

[0054] (1) Use TuMV-KpnI-F and Hcpro-2a-Myc-P3-R as primers, and use the plasmid containing the TuMV sequence as a template to amplify the first specific PCR band by PCR with high-fidelity DNA polymerase , and recover a specific PCR band, called PCR1;

[0055] TuMV-KpnI-F: tacgagacaagagc ggtacc aaatgggtcacggaaac,

[0056] Hcpro-2a-Myc-P3-R: gtcctcccattctgttcccaggtcctcctctgagatcagcttctgctctgttcctccaacgcggtagtgt, as shown in SEQ ID: No. 3, 6;

[0057] (2) Using Hcpro-2A-Myc-P3-F and TuMV-SnaBI-R as primers, and using the plasmid containing the TuMV sequence as a template, high-fidelity DNA polymerase was used to amplify the second specific PCR band by PCR , and recover a specific PCR band, called PCR2;

[0058] Hcpro-2A-Myc-P3-F:

[0059] acactaccgcgttggaggaacagagcagaagctga...

Embodiment 2

[0067] Such as figure 1 Shown is a method for inserting tags into the P3 protein of TUMOV, inserting Myc-GFP into the N-terminus of the pCambia2300-TuMV P3 protein. Specifically include the following steps:

[0068] (1) Using TuMV-KpnI-F and GFP-Myc-Hc-R as primers, using a plasmid containing the TuMV sequence as a template, using a high-fidelity DNA polymerase to amplify the first specific PCR band by PCR, and Recover specific PCR bands,

[0069] called PCR1;

[0070] TuMV-KpnI-F: tacgagacaagagc ggtacc aaatgggtcacggaaac,

[0071] GFP-Myc-Hc-R: aagttcttctcctttactcaggtcctcctctgagatcagcttctgctctgttcctccaacgcggta, as shown in SEQ ID: No.3 and No.8;

[0072] (2) Use Hc-Myc-GFP-F and P3-2A-GFP-R as primers, and use the plasmid containing the GFP sequence as the template, and use high-fidelity DNA polymerase to perform PCR to amplify the second specific PCR band , and recover a specific PCR band, called PCR2;

[0073] Hc-Myc-GFP-F: taccgcgttggaggaacagagcagaagctgatctcagaggagg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inserting a tag into the P3 protein of turnip mosaic virus and its recombinant vector and application. The method inserts the Myc tag and the Myc-GFP tag into the N of the P3 position in the TuMV invasive clone pCambia2300-TuMV end, enabling the expression of tagged Myc‑P3 protein and Myc‑GFP‑P3 protein. The constructed recombinant vector pCambia2300-TuMV: Myc-P3 and pCambia2300-TuMV: Myc-GFP-P3 have the following characteristics and advantages: (1) have infectivity, and the inserted label will not affect the infectivity of TuMV; (2 ) can express a specific tag fusion protein, which can be used for subsequent analysis of the function of TuMV P3 protein; (3) due to the high expression of the fusion protein, it is proved that P3 is an important functional gene of TuMV, and the tag antibody can be used for co-immunoprecipitation and screening (4) inserting the P3 protein with GFP fluorescent label, so as to observe the real function of the TuMV P3 protein under virus infection.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for inserting tags into the P3 protein of turnip mosaic virus and a constructed recombinant vector. Background technique [0002] Turnip mosaic virus (TuMV) is a single-stranded, positive-sense plant RNA virus belonging to the family Potatoviridae. TuMV can infect a variety of vegetable crops and oilseed crops of the Cruciferae family, and is an important pathogen in agricultural production in my country and the world. The general research on the function of plant viral protein is to use the transient expression vector based on 35S promoter to analyze the subcellular localization, protein expression and other functions of viral protein. However, the following problems exist in the study of viral protein functions based on the 35S promoter expression vector: (1) The 35S promoter is the promoter of cauliflower mosaic virus, which has high expression activity, resulting ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C12N15/65C12N15/40C07K14/08G01N33/569
CPCC07K14/005C12N15/65C12N15/8205C12N2770/34022G01N33/56983
Inventor李方方周雪平张明振
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI