Method for preparing recombinant virus and application of method

A recombinant virus and virus technology, applied in the field of genetic engineering, can solve the problems of complicated and tedious operation steps, difficult to control copy number, unable to insert at a fixed point, etc., and achieve the effects of simplifying screening steps, reducing the probability of causing adverse reactions, and convenient screening markers.

Pending Publication Date: 2019-08-30
SOUTH CHINA AGRI UNIV
View PDF12 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The disadvantages of RecA protein-mediated homologous recombination are: firstly, it needs longer homologous arms, and it can only be operated in Escherichia coli. The operation steps are complicated and cumbersome, and the false positive rate is high; It is space-time specific, high efficiency (not affected by the size and position of the target gene), accuracy (less non-specific recombination), and rapidity. The disadvantage is c

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing recombinant virus and application of method
  • Method for preparing recombinant virus and application of method
  • Method for preparing recombinant virus and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] 1) Construction of infectious clone p15A-H120

[0049] According to Genbank published three whole gene sequences (including 5'-UTR, 3'-UTR and Ploy (A)): FJ888351, FJ807652 and GU393335, the H120 whole gene sequence was divided into 4 segments and cloned into segments containing homology arms On the pBR322 vector, pBR322-H120 A~D is formed, and there are 50-70bβ overlapping regions between adjacent two segments as recombination homology arms. The first section of H120-A at the 5' end was added with a T7 promoter by PCR during the cloning process. Each fragment clone needs to be identified by enzyme digestion and sequenced to verify the correctness of the sequence, and then four fragments of DNA (H120-A~D) are obtained by enzyme digestion. Using the plasmid pUC57-HDVR-T7 ter as a template, the HDVR-T7 ter sequence containing the 3' homology arm of the genome was amplified by PCR as the fifth sequence of the H120 infectious clone. The structure of H120-A~D, HDVR-T7 ter ...

experiment example 1

[0090] Identification of rescued virus

[0091] RT-PCR detection

[0092] Take 200 μL of the rH120 F5 strain and rH120-Δ5a / H9 HA F5 virus solution to extract viral RNA according to the instructions of the Axyprep Body Fluid Virus DNA / RNA Small Extraction Kit, and dissolve the extracted RNA in 40 μL of RNase-free TE buffer. Recombinant DNase I (RNase-free) (Takara) instructions cleared DNA.

[0093] Using the above RNA as a template, primers

[0094] M-F: 5'-CCTAAGAACGGTTGGAAT-3';

[0095] M-R: 5'-TACTCTCTACACACACAC-3';

[0096] S1-F: 5'-AAGACTGAACAAAAGACCGACT-3';

[0097] S1-R: 5'-CAAAACCTGCCATAACTAACATA

[0098] -3'5ab-F:ACCACCTACACTACTTACTTG;

[0099] 5ab-R: ATTATCTGTGTGTTCCTCACAAG

[0100] By One-Step RT-PCR Kit PrimeScript TM One Step RT-PCR Kit Ver.2 manual amplifies M, S1 and 5ab genes. The amplification results of PCR products were observed by 1% agarose gel electrophoresis, see Figure 6 , and sent to Shanghai Sangon Bioengineering Company for sequencing.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for preparing a recombinant virus. The method comprises the steps of using a virus vector as a matrix, introducing a bidirectional screening gene through Red/ET recombination, performing further recombination to replace the bidirectional screening gene with a target gene to obtain recombinant plasmid containing the target gene and a virus genome, and further performing salvation so as to obtain the recombinant virus. The method disclosed by the invention has the beneficial effects that the method is simple in steps, construction of the recombinant virus can be accurately and quickly realized, the recombinant virus which is successfully constructed can accommodate exogenous genes, advantages of multi-site orienteering inserting, traceless inserting and convenient mark screening can be realized, the recombinant virus which can express various antigen genes is formed finally, the recombinant virus is applied to vector vaccines, and the recombinant virus also has the advantages that the host range is wide, the production and preparation method is simple, the safety is good, various immune reactions are induced at the same time, and adjuvants do not needto be added.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and more specifically relates to a method for preparing a recombinant virus and its application. Background technique [0002] Vaccination is one of the important ways to isolate the channels of disease transmission between animals and humans. At present, my country has developed a variety of vaccines for different types of diseases, including genetic engineering vaccines. With the rapid development of recombinant technology, genetically engineered vaccines have also been more widely used in the prevention and control of animal infectious diseases, and have laid a solid foundation for improving the effectiveness of infectious disease prevention and control. [0003] In recent years, recombinant viral vector vaccines have received extensive attention. It is obtained by inserting exogenous protective antigen genes into the viral genome, and the recombinant virus immunizes the body to e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/70C12N15/66C12N7/01A61K39/145A61P31/16
CPCC12N15/70C12N15/66C12N7/00A61K39/12A61P31/16A61K2039/552C12N2770/20021C12N2770/20034
Inventor 谢青梅封柯宇邵冠明邵洋洋张新珩
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap