A kind of gst membrane type expression vector containing thrombin cleavage site and method for transfecting positive cells

A technology of cleavage sites and expression vectors, applied in the field of cell transfection, can solve the problems of inconvenience, occupancy, increased consumption of experimental reagents and costs, etc., and achieve the effect of simplifying the screening steps and increasing the ratio

Active Publication Date: 2016-01-20
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still deficiencies in this scheme: after sorting with anti-GFP antibody and immunomagnetic beads, the surface of positive cells is still bound to GFP, antibodies, immunomagnetic beads and other components, which has a certain impact on subsequent cell biology research. ; GFP itself emits green fluorescence. If immunostaining and fluorescence microscopy or flow cytometry analysis is performed, GFP occupies the most commonly used 488 / 515nm fluorescence channel, which brings some inconvenience to the experimental design and increases the consumption and cost of experimental reagents.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of gst membrane type expression vector containing thrombin cleavage site and method for transfecting positive cells
  • A kind of gst membrane type expression vector containing thrombin cleavage site and method for transfecting positive cells
  • A kind of gst membrane type expression vector containing thrombin cleavage site and method for transfecting positive cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Example 1: Construction of pIRES-mGST-CD155 vector

[0097] The CD155 gene was inserted into the pIRES-mGST vector. The CD155 gene was derived from the cDNA of human peripheral blood mononuclear cells PBMC. According to the pIRES-mGST multiple cloning site restriction enzyme site and the CD155 open reading frame (ORF) gene sequence, primers were designed to introduce the XhoI and EcoRI enzyme site , primer sequences and high-fidelity PCR reaction conditions are as follows:

[0098] P1: cc gctcgag atggcccgagccatggccgc (XhoI site is underlined)

[0099] P2:cg gaattc ccttgtgccctctgtctgtg (the EcoRI site is underlined)

[0100] The PCR reaction system includes: human cDNA: 1 μg, primers P1 and P2 (10 μmol / L) 5 μl each, dNTP mixture 20 pmol, high-fidelity DNA polymerase PrimerStar (TaKaRa company) 5 units, 5×PCRBuffer20 microliter, double distilled water 81.4 microliters. Reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec; annealin...

Embodiment 2

[0102] Example 2: Transfection of CHO cells with pIRES-mGST-CD155 vector

[0103] Use DMEM cell culture medium containing 10% newborn calf serum to culture CHO cells in a 75cm2 culture flask until the confluency reaches 80%, suck up the medium, digest with 0.25% trypsin-0.02%EDTA-PBS buffer, and make the cells Change to a suspended state, transfer the cells into a 15ml centrifuge tube, centrifuge at 1200rpm for 5min, discard the supernatant, resuspend the cell pellet with an appropriate volume of electroporation buffer, then centrifuge at 1200rpm for 5min, discard the supernatant, and wash the cells twice , make a single cell suspension, count the cells, resuspend the cells in the electroporation buffer, and adjust the final cell concentration to 1×10 7 cells / ml. Take 1 ml of the cell suspension and put it into the electroporation cup, add 50 micrograms of the recombinant vector pIRES-mGST-CD155, put it in ice bath for 10 minutes, and transfect the CHO cells by electroporatio...

Embodiment 3

[0104] Example 3: Immunomagnetic bead sorting of transfected positive cells

[0105] Main commercial reagents and equipment: Secondary Antimagnetic Beads CELLection TM PanMouseIgGKit Kit (Dynal Company, Cat. No. 115-31D); Magnetic Rack DynalMPC-S (Dynal Company, Cat. No. 120-20D); RPMI1640 Cell Culture Medium (Hyclone Company); Newborn Calf Serum (Sijiqing Company); Bovine Serum Albumin BSA (Sigma Company); vertical mixer (HS-3 type of Ningbo Xinzhi Company). Murine monoclonal antibody (mAb, clone number FMU-GST.3) specifically binding to GST.

[0106] Sorting steps:

[0107] Take 100ul secondary antibody magnetic bead suspension (containing 4×10 7 magnetic beads), add 1ml Buffer1 to wash fully, let stand on the magnetic rack for 1min, aspirate and discard the supernatant, add 1ml Buffer1 and mix well, add 2μg monoclonal antibody FMU-GST. ℃, 30-60min. Let stand on the magnetic rack for 1 min, discard the supernatant, and wash twice with Buffer1;

[0108] After electropor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The present invention discloses a thrombin cleavage site-containing GST membrane expression vector and a method for sorting transfected positive cells. After the GST is expressed, pieces cell membrane under the guidance of a signal peptide, and is fixedly attached to the surface of the cell membrane and become a novel screening tag of transfected cells, namely membrane GST; and through specific binding and immunomagnetic beads adsorption targeting monoclonal antibodies against GST, cells are sorted, screening steps are simplified, positive cells are enriched, and the transfected positive cell ratio is improved. According to the invention, positive cells can be effectively enriched, the transfected positive cell ratio can be improved, so the method is a technical means that can high efficiently sorting transfected positive cells; and through the sorting of the method, positive cells are enriched, with a proportion of positive cells increasing to more than 95%.

Description

technical field [0001] The invention belongs to the technical field of cell transfection, and relates to a GST membrane expression vector containing a thrombin cleavage site and a method for transfecting positive cells. Background technique [0002] In modern life science research, in order to explore the function of a specific gene, it is often necessary to overexpress the protein product encoded by the gene in eukaryotic cells; or to change the biological state of eukaryotic cells by overexpressing a certain protein molecule, To study the function of cells; or large-scale culture of eukaryotic cells to produce specific protein products. In this case, the most commonly used technical method is to introduce foreign genes into host cells by using plasmids or virus vectors, so that the foreign genes can be amplified, transcribed, and translated into protein products in the host cells. This technology has a key bottleneck problem, which is the low transfection efficiency. As a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/63C12N15/66C12N5/10
Inventor 张圆庄然李琦张赟金伯泉
Owner FOURTH MILITARY MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap