A recombinant bacterium expressing d-threonine aldolase and its construction method and application

A technology of threonine aldolase and recombinant bacteria, applied in the field of enzyme engineering, can solve problems such as few research reports, and achieve the effects of strong stereoselectivity, wide substrate applicability and mild reaction conditions

Active Publication Date: 2022-05-03
JIANGNAN UNIV
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on enzymatic synthesis of l-syn-p-thymphenylphenylserine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant bacterium expressing d-threonine aldolase and its construction method and application
  • A recombinant bacterium expressing d-threonine aldolase and its construction method and application
  • A recombinant bacterium expressing d-threonine aldolase and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: Screening D-threonine aldolase based on gene mining technology of probe enzyme sequence

[0028] According to the gene sequence of D-threonine aldolase (Alcaligenesxylosoxydans) which has been reported to have aldehyde condensation into p-thymphenylphenylserine, use this sequence as a probe to search in the NCBI database and compare and analyze it by BLAST, find the same For candidate enzyme genes with 40% to 70% homology in the probe sequence, select enzyme genes with high sequence consistency, and ensure that the source strains of these enzyme genes are different from the probe species, and then design primers based on the retrieved gene sequences , using PCR amplification to obtain the DNA encoding these enzymes, and they are cloned and expressed, and finally by screening the activity and stereoselectivity of the target substrate (p-thiamphenicol benzaldehyde), high activity and high selectivity can be obtained. Sexual D-threonine aldolase.

Embodiment 2

[0029] Embodiment 2: Cloning of D-threonine aldolase gene

[0030] The "one-step cloning method" (homologous recombination) was used to construct the recombinant plasmid pET28a-ApDTA.

[0031] (1) First use nutrient broth agar medium (peptone 10.0g, beef extract 3.0g, NaCl 5.0g, agar 15.0g, distilled water 1.0L, pH 7.0) to activate and rejuvenate the above-mentioned Leucobacterium skin type at 25°C . Then, after the colony grows, the single colony is inserted into the liquid medium for culture. After the cells were obtained by centrifugation, the bacterial genome DNA kit was used to extract the genomic DNA of Achromobacter piformis.

[0032] (2) Design primers according to the reported D-threonine aldolase gene (upstream primer: CAGCAAATGGGTCGC GG ATCC ATGTCCCAGGAAGTCATACGCG, downstream primer: TGCGGCCGCAAGCTT GTC GAC TCAGCGCGAGAAGCCGCG, where GGATCC is the BamHI restriction site and GTCGAC is the SalⅠ restriction site), PCR was performed using the genomic DNA of Achro...

Embodiment 3

[0033] Example 3: Construction and cultivation of recombinant Escherichia coli BL21(DE3) / pET28a-ApDTA

[0034] Plasmid pET28a was double digested with restriction endonucleases BamH I and Sal I in a water bath at 37°C for 4 hours, identified by agarose gel electrophoresis, and the target fragment was purified and recovered using an agarose DNA recovery kit. At 37°C, use the recombinase in the recombination kit to connect the gene ApDTA with the digested plasmid pET28a to obtain the recombinant expression vector pET28a-ApDTA ( figure 2 ). Heat the constructed recombinant expression vector pET28a-ApDTA into Escherichia coli BL21(DE3) competent, coat a solid plate containing kanamycin-resistant LB, and perform colony PCR verification after overnight culture. The positive clone is the gene Recombinant engineering bacteria E.coli BL21(DE3) / pET28a-ApDTA. Pick positive clones and culture them overnight in LB medium, transfer them to fresh LB medium the next day at 2% inoculum size...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant bacterium expressing D-threonine aldolase and its construction method and application, belonging to the technical field of enzyme engineering. The recombinant bacterium of the present invention expresses the D-threonine aldolase whose amino acid sequence is shown in SEQ ID NO.2. The present invention provides a D-threonine aldolase that can be used as a catalyst for the synthesis of chiral β-hydroxy-α-amino acids, which has high catalytic efficiency (conversion rate>65%) and strong stereoselectivity (e.e.> 99%, d.e.>95%), the applicable reaction conditions are mild, and the environment is friendly. The D-threonine aldolase of the invention has good catalytic effect, wide substrate applicability, and good application and development prospects.

Description

technical field [0001] The invention relates to a recombinant bacterium expressing D-threonine aldolase and its construction method and application, belonging to the technical field of enzyme engineering. Background technique [0002] Chiral β-hydroxy-α-amino acid is a very important class of compounds, because it has two functional groups of chiral hydroxyl and amino acid, it has a very wide range of applications in the manufacture of fine chemicals such as medicine and materials. The chemical synthesis of chiral β-hydroxy-α-amino acids has the disadvantages of expensive catalysts, heavy metal pollution, long synthetic routes, and the stereoselectivity of products can only be improved under harsh conditions, which is not conducive to the scale-up of industrial production. Compared with the chemical method, the enzymatic method does not require any protecting group, has better stereoselectivity, and the reaction can be completed in one step. Therefore, enzymatic synthesis o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/70C12P13/04C12P13/06C12R1/19
CPCC12N9/88C12N15/70C12P13/04C12P13/06C12Y401/02042
Inventor倪晔龚磊许国超
OwnerJIANGNAN UNIV