Unlock instant, AI-driven research and patent intelligence for your innovation.

Application method of tomato mir6027 gene in controlling plant fruit color

An application method, tomato technology, applied in the application field of tomato miR6027 gene in controlling plant fruit color

Active Publication Date: 2021-12-10
YULIN NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, although STTM has been applied to the silencing of tomato miRNA function (Jiang et al.2018; Kravchik et al.2019), there are few reports on the use of STTM to inhibit miRNAs related to fruit development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application method of tomato mir6027 gene in controlling plant fruit color
  • Application method of tomato mir6027 gene in controlling plant fruit color
  • Application method of tomato mir6027 gene in controlling plant fruit color

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The materials used: E. coli DH5α, Agrobacterium EHA105, plant expression vector PCAMIBA-35S is derived from the Molecular Biological Laboratory of Yulin Normal University, and the Clon Carrier PEASY-BLUNT Clong Kit is purchased in Transgene. Oligonucleotides are synthesized by Frequency Bioengineering (Shanghai) Co., Ltd., DNA polymerase, restriction endonuclease (KPNI, BAMH I) and T4 ligation enzyme purchase in Thermo Fisher Scientific, plasmid extraction kit and gel Recycling kits are purchased in Omega.

[0030] 1.PCamba1300-SMMT6027 Silenced Expression vector

[0031] The oligonucleotide sequences of the STTM silencing carrier are designed according to SL-Mir6027 mature sequences, and the sequences are designed to be as follows:

[0032] F-sttm6027: ggagaggacaggctaccccccgaaggattccccccccccccccccccccccccccccccccccccccgaaggattcctaacgageaaacagttgtgtgttatgg,

[0033] R-sttm6027: ctctagaggatccctgttctcgtctagaatccttcgggcattcttctttagca,

[0034] Linker-sttm: gttgttgttgttggtctaat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application method of tomato miR6027 gene in controlling the color of plant fruit, relates to the application of plant gene, and aims to obtain a method capable of controlling the expression of miR6027 gene and regulating the color of fruit. The application method of the tomato miR6027 gene in controlling the color of plant fruit is as follows: the miR6027 precursor sequence is used to construct the pCambia1300-SMMT6027 silent expression vector, and then the tomato is transformed by the Agrobacterium-mediated method, and the fruit color is regulated by the tomato miR6027 gene. The present invention explores the function of Sl-miR6027 in fruit ripening by constructing STTM-6027 silencing expression vector, which can not only provide potential gene resources for genetic engineering to improve fruit color, but also can carry out the function of miRNA related to fruit development through STTM technology Research lays the technical foundation.

Description

Technical field [0001] The present invention relates to the application of plant genes, and specifically, the application method of tomato miR6027 gene in controlling plant fruit color is specifically involved. Background technique [0002] At present, a large number of differential expressions related to fruit development and maturity miRNAs were discovered (ZuO et al. 2012; GAO C et al. 2015). Such as: Tomato MiR161, MiR173, MiR393, MiR397, MiR398 and Mir414 have only increased expression in the green ripening. The expression of MiR159 decreased in fruits in the ruins of the color, and the red ripe period increased; Mir156 and Mir394 were expressed in maturity Decreased, MiR396 expressed significantly in the expression of broken color; MiR828 and MiR1917 expression decreased in red ripening period (Zuo et al.2012). MiRNAs not only exhibited differential expression patterns in various periods of fruit, but some of these miRNAs were regulated by ethylene, such as: Tomato MiR394, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/113A01H5/08A01H6/82
CPCC12N15/8218C12N15/113C12N15/825C12N2310/14
Inventor 任振新史列琴
Owner YULIN NORMAL UNIVERSITY