Application method of tomato mir6027 gene in controlling plant fruit color
An application method, tomato technology, applied in the application field of tomato miR6027 gene in controlling plant fruit color
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The materials used: E. coli DH5α, Agrobacterium EHA105, plant expression vector PCAMIBA-35S is derived from the Molecular Biological Laboratory of Yulin Normal University, and the Clon Carrier PEASY-BLUNT Clong Kit is purchased in Transgene. Oligonucleotides are synthesized by Frequency Bioengineering (Shanghai) Co., Ltd., DNA polymerase, restriction endonuclease (KPNI, BAMH I) and T4 ligation enzyme purchase in Thermo Fisher Scientific, plasmid extraction kit and gel Recycling kits are purchased in Omega.
[0030] 1.PCamba1300-SMMT6027 Silenced Expression vector
[0031] The oligonucleotide sequences of the STTM silencing carrier are designed according to SL-Mir6027 mature sequences, and the sequences are designed to be as follows:
[0032] F-sttm6027: ggagaggacaggctaccccccgaaggattccccccccccccccccccccccccccccccccccccccgaaggattcctaacgageaaacagttgtgtgttatgg,
[0033] R-sttm6027: ctctagaggatccctgttctcgtctagaatccttcgggcattcttctttagca,
[0034] Linker-sttm: gttgttgttgttggtctaat...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


