A kind of hydrolysis method of zearalenone and derivatives thereof
A technology for zearalenone and zearalenol is applied in the field of hydrolysis of zearalenone and its derivatives, and can solve problems such as low relative activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Preparation and Purification of Zearalenone Degrading Enzyme
[0035] (1) Artificial synthesis of gene sequence
[0036] Entrusted Wuhan Jinkairui Bioengineering Co., Ltd. to synthesize the nucleotide sequence shown in SEQ ID NO: 3, and insert the sequence into the plasmid vector pET28a, and save it for future use.
[0037] The sequence of SEQ ID NO:3 is as follows:
[0038] atgccagctcagagaaccagatccaccgttagaactaacgacggtatcacctggtactacgagcaagaaggttctggtccagacatcgttttgatcccagatggtgttggtgactgcggtttgttcgatcagccaatgtctactattgcctcctccggtttcagagttaccactttcgatatgccaggtatgtccagatctgctgctactgctccaccagaaacttaccaagacgttaccggtcaaaagctggccggttacatcgttactttgatggacgagttgggtatcaagtccgctgctgtttggggttgttcttctggtgctactactgttttggccctgtgttctggtttcccagacagagttagaaacggtatgccacacgaggttccaactgttaacccagacaacctgaagaacatccacgaggttactgacactgacgctttgactgctgaattggctgctaccatcagaactatgtctgctaacgaagctgcttgggatgctttgggtgctgaagttcacgaaagactgagaggtaactacgctagatgggcttacggttacccaagaactattccaggttccgc...
Embodiment 2
[0062] Example 2 Using zearalenone as a substrate to verify the function of zearalenone-degrading enzymes
[0063] The enzyme activity unit is defined as the amount of enzyme required to degrade 1 μg of the substrate zearalenone within 1 min as an enzyme activity unit U.
[0064] (1) Optimum temperature
[0065] The Zhd11B pure enzyme solution in Step 5 of Example 1 was diluted with 50 mM Tris-HCl buffer solution of pH 8.0, and the enzyme activity was measured with the diluted enzyme solution. The diluted enzyme solution was recorded as the diluted enzyme solution.
[0066] The composition of solution A: consists of 50 mM Tris-HCl buffer solution with pH 8.0 and zearalenone solution; the final concentration of the substrate zearalenone in the reaction system 0.5 mL is 10.0 μg / ml.
[0067] Experimental group: The reaction system for activity determination is 0.5mL, diluted with 0.45mL solution A and 0.05mL enzyme solution; the pH value of the reaction system is 8.0; mL of ch...
Embodiment 3
[0090] Example 3 Zearalenone degrading enzyme Zhd11B point mutation
[0091] The 158th position of the zearalenone degrading enzyme Zhd11B of the amino acid sequence shown in SEQ ID NO: 1 is mutated from threonine to histidine to obtain the zearalenone degrading enzyme Zhd11B (T158H), after the point mutation The amino acid sequence of zearalenone degrading enzyme Zhd11B (T158H) is shown in SEQ ID NO:2, and the nucleotide sequence of the coding gene is shown in SEQ ID NO:4. in,
[0092] SEQ ID NO:2
[0093] Met Pro Ala Gln Arg ThrArg Ser Thr Val Arg Thr Asn Asp Gly Ile ThrTrp Tyr Tyr Glu Gln Glu Gly Ser Gly Pro Asp Ile Val Leu Ile Pro Asp Gly ValGlyAsp Cys Gly Leu Phe Asp Gln Pro Met Ser Thr Ile Ala Ser Ser Gly Phe ArgVal Thr Thr Phe Asp Met Pro Gly Met SerArg SerAlaAla ThrAla Pro Pro Glu ThrTyr GlnAsp Val Thr Gly Gln Lys Leu Ala Gly Tyr Ile Val Thr Leu Met Asp GluLeu Gly Ile Lys Ser Ala Ala Val Trp Gly Cys Ser Ser Gly Ala Thr Thr ValLeuAla Leu Cys Ser Gly Phe Pro Asp Arg V...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


