Adenovirus vector vaccine for preventing SARS-CoV-2 infection
A virus vector, sars-cov-2 technology, applied in DNA/RNA vaccination, virus/bacteriophage, double-stranded DNA virus, etc., can solve problems such as low expression, insufficient resistance to virus infection, and invalid vaccine titer , to achieve a good security effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0037] The amino acid sequence of the Spike protein (S) of SARS-CoV-2 is shown in YP_009724390.1, denoted as NB1.
[0038] The pre-mRNA transcribed by eukaryotic cells can produce different mRNA splicing isoforms through different splicing methods (selecting different combinations of splicing sites), which ultimately leads to different proteins produced by the same gene sequence. This is very detrimental to protein expression. The inventor optimized the codon of the wild-type natural nucleic acid sequence and removed potential variable splicing sites based on his own technology, which ensured the uniqueness of protein expression and reduced the difficulty of subsequent protein purification. The optimized nucleic acid sequence is denoted as NB2, and its specific sequence is shown in SEQ ID NO: 1:
[0039]ATGTTCGTGTTTCTGGTGCTGCTGCCTCTGGTGAGCTCCCAGTGCGTGAACCTGACCACAAGGACCCAGCTGCCACCTGCCTATACCAATAGCTTCACACGGGGCGTGTACTATCCCGACAAGGTGTTTAGATCTAGCGTGCTGCACTCCACCCAGGATCTGTTTCTGCCTTTCT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

