Adenovirus vector vaccine for preventing SARS-CoV-2 infection

A virus vector, sars-cov-2 technology, applied in DNA/RNA vaccination, virus/bacteriophage, double-stranded DNA virus, etc., can solve problems such as low expression, insufficient resistance to virus infection, and invalid vaccine titer , to achieve a good security effect

Active Publication Date: 2020-04-10
GUANGZHOU N BIOMED LTD
View PDF10 Cites 67 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, experiments have shown that the natural SARS-CoV-2 spike protein S gene has a low expression level in the human body. If it is expressed as an antigen with ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adenovirus vector vaccine for preventing SARS-CoV-2 infection
  • Adenovirus vector vaccine for preventing SARS-CoV-2 infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The amino acid sequence of the Spike protein (S) of SARS-CoV-2 is shown in YP_009724390.1, denoted as NB1.

[0038] The pre-mRNA transcribed by eukaryotic cells can produce different mRNA splicing isoforms through different splicing methods (selecting different combinations of splicing sites), which ultimately leads to different proteins produced by the same gene sequence. This is very detrimental to protein expression. The inventor optimized the codon of the wild-type natural nucleic acid sequence and removed potential variable splicing sites based on his own technology, which ensured the uniqueness of protein expression and reduced the difficulty of subsequent protein purification. The optimized nucleic acid sequence is denoted as NB2, and its specific sequence is shown in SEQ ID NO: 1:

[0039]ATGTTCGTGTTTCTGGTGCTGCTGCCTCTGGTGAGCTCCCAGTGCGTGAACCTGACCACAAGGACCCAGCTGCCACCTGCCTATACCAATAGCTTCACACGGGGCGTGTACTATCCCGACAAGGTGTTTAGATCTAGCGTGCTGCACTCCACCCAGGATCTGTTTCTGCCTTTCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an adenovirus vector vaccine for preventing SARS-CoV-2 infection. The vaccine comprises a nucleic acid sequence as shown in SEQ ID NO: 1. According to a plurality of embodiments of the invention, the S protein nucleic acid sequence contained in the vaccine is easy to express in human cells, and generation of more S proteins can be induced, so the vaccine is expected to be used as a recombinant virus vaccine for preventing SARS-CoV-2 infection. According to a plurality of embodiments of the invention, the vaccine has good security.

Description

technical field [0001] The invention relates to an adenovirus vector vaccine for preventing SARS-CoV-2 infection. Background technique [0002] The new coronavirus SARS‑CoV‑2 has an incubation period of up to 24 days and is highly contagious. Unlike the SARS virus that caused SARS, some cases are contagious during the incubation period, and some virus carriers do not show any obvious symptoms. This has increased the difficulty of epidemic prevention and control. Therefore, the rapid development of preventive vaccines that can improve the level of herd immunity and block the spread of the virus has become the most urgent major demand in my country. [0003] For the new coronavirus, there are currently no specific proven antiviral drugs and preventive vaccines at home and abroad. Therefore, prevention and blocking the spread of the virus are the key to controlling the epidemic. The application of vaccines has played an irreplaceable role in eliminating many infectious disea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/215A61P31/20C12N15/861
CPCA61K39/12A61K2039/5256A61K2039/53A61P31/20C12N15/86C12N2710/10343C12N2770/20034C12N2800/107
Inventor 陈凌杨臣臣刘晓琳
Owner GUANGZHOU N BIOMED LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap