KASP Molecular Marker and Its Application of the Main Qtl for Spikelet Fruity at the Top of Wheat Spike

A molecular marker and wheat technology, applied in the field of molecular genetic breeding, can solve problems such as the slow progress in genetic research of ear top fruitiness and the difficulty of complex research on the mechanism of ear top fruitiness, so as to improve breeding efficiency, reduce time and labor costs, and improve The effect of detection efficiency

Active Publication Date: 2022-04-22
SHANXI AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, research on the genetics of ear top fruitiness in major food crops is progressing slowly, which to some extent explains that the mechanism of ear top fruitiness is complex and difficult to study

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • KASP Molecular Marker and Its Application of the Main Qtl for Spikelet Fruity at the Top of Wheat Spike
  • KASP Molecular Marker and Its Application of the Main Qtl for Spikelet Fruity at the Top of Wheat Spike
  • KASP Molecular Marker and Its Application of the Main Qtl for Spikelet Fruity at the Top of Wheat Spike

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] [Mining significant association loci controlling panicle top spikelet fruiting by genome-wide association analysis]:

[0032] Test materials: The natural population used for association analysis consists of 220 wheat varieties, of which 213 are from China and 7 are from abroad. Among the 7 materials from abroad, 3 were from Italy, 1 from the United States, 1 from Mexico, 1 from Chile, and 1 from Japan; among the 213 materials from China, 65 were from Jiangsu, 25 from Henan, 19 from Shandong, and 18 from Shaanxi 16 in Sichuan, 13 in Anhui, 10 in Hunan, 6 in Hubei, 7 in Beijing, 7 in Hebei, 4 in Gansu, 3 in Zhejiang, 3 in Fujian, 3 in Shanxi, 2 in Heilongjiang, 1 in Jiangxi, 1 in Guizhou and 1 in Yunnan, and 9 materials of unknown origin.

[0033] Field test: The tested natural populations were planted in Jingzhou, Hubei and Yangzhou, Jiangsu in 2013-2014 and 2014-2015 respectively, and in Xinxiang, Henan in 2015-2016. The field experiment was designed according to rand...

Embodiment 2

[0038] 【Positioning the main QTL controlling the number of grains set in spikelets at the top of the panicle】:

[0039] Test materials: Yangmai 17 and Ningmai 9 are the main winter wheat varieties in the middle and lower reaches of the Yangtze River in my country. Yangmai 17 has excellent comprehensive agronomic properties, but poor ear firmness. One of the main characteristics of Ningmai 9 is ear firmness Good sex. The present invention uses Yangmai 17 as the female parent and Ningmai 9 as the male parent to construct F 2：7 Generation RIL population, including 190 families.

[0040] Field experiment: The tested genetic population and its parents including 190 families were identified in Yangzhou, Jiangsu, Nanjing, and Yizheng, Jiangsu, respectively, from 2017 to 2019. The field experiment was designed according to random blocks, and three repetitions were set up. In each repetition, each material was planted in 3 rows, 50 grains / row, the row length was 2 meters, and the row ...

Embodiment 3

[0046] [Development of KASP molecular markers for main QTL of spikelet fruiting at the top of wheat spikelets]:

[0047] According to the characteristics of SNP mutation information, a specific set of KASP primers is designed, which consists of the first upstream primer, the second upstream primer and the downstream primer. The 3' end of the upstream primer set is the allelic variant base A / G, and the sequence selection of the downstream primers should ensure that the length of the amplified product is 60-120bp. The sequence of the first upstream primer is 5'-GAAGGTGACCAAGTTCATGCTGGTTGATCAAACGCGCCATACTTCA-3', the sequence of the second upstream primer is 5'-GAAGGTCGGAGTCAACGGATTGGTTGATCAAACGCGCCATACTTCG-3'; the sequence of the downstream primer is 5'-ATGTTGGTTAATTTGTCATGTTGAC-3'. Wherein, the 5' end of the first upstream primer is connected to the FAM fluorescent tag sequence "GAAGGTGACCAAGTTCATGCT", and the 5' end of the second upstream primer is connected to the HEX fluoresc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

This case involves a KASP molecular marker and its application of the major QTL for spikelet fruitiness at the top of the wheat ear. Primers were designed according to the target SNP site, and the corresponding SNP was typed by using the specific matching of the bases at the end of the primer. The present invention is developed by excavating the closely linked markers of the main effect QTL of spikelet number at the top of wheat spikelets. The designed KASP molecular marker has a large and stable genetic effect and is closely linked with the target QTL, which is important for improving the spikelet fruiting at the top of wheat spikelets. Practical significance, providing excellent genetic resources and selection tools for molecular breeding of wheat yield traits, greatly improving the selection efficiency.

Description

technical field [0001] The invention belongs to the technical field of molecular genetic breeding, and in particular relates to a KASP molecular marker of a major QTL for spikelet fruitiness at the top of wheat ears and an application thereof. Background technique [0002] my country's wheat genetic improvement has a history of 100 years, and the varieties have undergone 4-6 replacements. Compared with the early days of the founding of the People's Republic of China, the wheat yield has also made a qualitative leap. However, in recent years, with the increase of population and the continuous decrease of arable land area, in order to meet people's increasing demand, it is necessary to achieve this goal by increasing the yield per unit area. At present, the yield factors of wheat varieties have reached a good level of coordination, and increasing the number of grains per ear has the greatest synergistic effect on the number of grains per unit area. Therefore, studying the con...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 郭杰施卫萍程顺和岳琳祺郭佳晖
Owner SHANXI AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap