Organochlorine pesticide ddt nucleic acid aptamer and its application

A nucleic acid aptamer and organochlorine technology, applied in the biological field, can solve problems such as complex processing, expensive instruments, and inability to analyze and detect a large number of samples

Active Publication Date: 2022-07-29
HUAQIAO UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection method of DDT and its metabolites is gas chromatography. This method is complicated in sample pretreatment, expensive instruments are required, and it is not suitable for the analysis and detection of a large number of samples.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Organochlorine pesticide ddt nucleic acid aptamer and its application
  • Organochlorine pesticide ddt nucleic acid aptamer and its application
  • Organochlorine pesticide ddt nucleic acid aptamer and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1D

[0034] Example 1 Screening of DDT nucleic acid aptamers

[0035] like figure 1 As shown, the present embodiment adopts SELEX technology, by fixing the library, and using the method of target elution to carry out nucleic acid aptamer screening, as follows:

[0036] 1. Immobilization of nucleic acid library and matrix (SA agarose magnetic beads)

[0037] The ssDNA nucleic acid aptamer library synthesized by Sanko is used, and the library information is 5'-TCCAGCACTCCACGCATAAC(SEQ ID NO.18)(Nn)GTTATGCGTGCGACGGTGAA(SEQ ID NO.19)-3', wherein n=20-60, preferably n=40; ​​for the first round of screening, the 1OD library was dissolved in 260 μL Binding buffer (1 mM CaCl 2 , 2.5mM KCl, 1.5mM KH 2 PO 4 , 0.5mM MgCl 2 *6H 2 O, 137mM NaCl, 8mM Na 2 HPO 4 , pH 7.2), followed by annealing hybridization with 2-fold concentration of the upstream primer containing Biotin modification (5'-GTTATGCGTGGAGTGCTGGA-C6-Biotin-3', SEQ ID NO.20), the annealing procedure was 95°C for 10min; then...

Embodiment 2

[0052] Example 2 Cloning and sequencing of nucleic acid aptamers and prediction of secondary structure of candidate nucleic acid aptamers

[0053] 1. Recovery of PCR products

[0054] Unmodified upstream and downstream primers were used to amplify the last round of screening in Example 1, followed by non-denaturing gel separation, cutting the gel to recover the target band, and using the ploy-gel gel recovery kit to recover the target product.

[0055] 2. Conversion of ligation and ligation products

[0056] 1. Add 0.5μL TAKARA pMDT-19T simple vector, 4.5μL nucleic acid aptamer PCR product and 5μL Solution I to a microcentrifuge tube;

[0057] 2. Reaction at 16°C for 3h;

[0058] 3. Add the full amount (10 μL) to 100 μL of DH5a competent cells, and place in ice for 30 min;

[0059] 4. After heat shock at 42°C for 90s, place on ice for 2min;

[0060] 5. Add 800 μL of pre-warmed LB medium at 37°C (without resistance), and incubate at 37°C with shaking at 220 RPM for 60 minut...

Embodiment 3

[0068] Example 3: Preliminary characterization of nucleic acid aptamers and determination of dissociation constant (Kd)

[0069] Using SYBR Green I (SGI) dye method, this method mainly uses nucleic acid aptamer to increase its secondary structure to a certain extent after binding to the target, thereby causing the continuous increase of SGI signal.

[0070] 1. Incubation of aptamer and target

[0071] The aptamers were incubated with the same concentration (200 nM) or different concentrations of the target (0-530 nM) for 45 min on a circular mixer.

[0072] 2. Incubation of aptamer-target complexes with SGI

[0073] The aptamer-target complex and SGI (final concentration of 1x) were incubated circumferentially, room temperature, for 2 h.

[0074] 3. Determination by fluorescence spectrophotometer

[0075] Fluorescence photometry was performed using a Hitachi F-7000 fluorescence spectrophotometer. Excitation wavelength EX 495; emission wavelength Em 505; slit excitation and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an organochlorine pesticide DDT nucleic acid aptamer, including at least one of DDT-01 to 17, wherein the DDT-01 to 17 have sequences as shown in SEQ ID NO. 01 to 17 in sequence. The nucleic acid aptamer of the present invention can recognize DDT with high specificity and bind with high affinity, and can be applied to related methods for detecting DDT of organochlorine pesticides, in the detection of DDT residues in animal bodies and water bodies, and in reducing the effect of DDT on human body. is of great significance in terms of violations.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an organochlorine pesticide DDT nucleic acid aptamer and its application. Background technique [0002] The organochlorine pesticide DDT (Dichlorodiphenyltrichloroethane, DDT) has been used on a large scale around the world due to its broad spectrum, high efficiency and low cost, but it is extremely difficult to decompose in nature and poses a long-term threat to human health and ecological security. , the results of the study found that DDT and its metabolites can induce different types of apoptosis, resulting in increased susceptibility of the body to cancer. From 1970 to 1980, the world began to completely ban the use of DDT pesticides. my country also stopped the production and use of such organochlorine pesticides in 1983. However, recent investigations have found that residues can still be detected in food in my country. DDT, and the average is much higher than othe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/115G01N33/53
CPCC12N15/115G01N33/5308C12N2310/16G01N2430/10
Inventor林俊生张伟
OwnerHUAQIAO UNIVERSITY