Unlock instant, AI-driven research and patent intelligence for your innovation.
Allelic specific site editing method
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
An allele-specific and site-specific technology, applied in the field of gene editing and site-specific site editing, to achieve the effects of reducing the chimerism rate, expanding the scope of application, and facilitating mechanism research
Active Publication Date: 2020-08-11
SHANGHAI FIRST MATERNITY & INFANT HOSPITAL
View PDF5 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, this technology does not solve the aforementioned problems well
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0051] 1 Experimental materials
[0052] Experimental animals: C57BL / 6 female mice were used to obtain MII oocytes and fertilized eggs; DBA and PWK male mice were used to obtain mature sperm.
[0056] For the specific operation steps involved in the Past-CRISPR method and genotype identification of embryos in the experiment, please refer to the above "main operation steps". The traditional fertilized egg injection experiment was set as the control group, that is, the fertilized eggs at the PN3-4 stage were injected with the same concentration of Cas9 / sgRNA. The genotypes of single embryos obtained by the Past-CRISPR method and the traditional fertilized egg injection method were compared and analyzed by using the Snap...
Embodiment 2
[0068] 1 Experimental materials
[0069] Experimental animals: C57BL / 6 and BDF1 female mice were used to obtain MII oocytes and fertilized eggs; DBA and PWK male mice were used to obtain mature sperm; ICR pseudopregnant female mice were used for embryo transfer.
[0073] For the specific operation steps of the Past-CRISPR method involved in the experiment, refer to the above "main operation steps". The genotype identification of the born mice was determined by comparing and analyzing the Sanger sequencing results by using the mouse tail identification method.
[0074] sgRNAs used:
[0075] Anapc2 CTTTGGTGGGACTGCACCGCTGG SEQ ID NO:10
[0083] Experimental animals: C57BL / 6 female mice were used to obtain MII oocytes and fertilized eggs; DBA and PWK male mice were used to obtain mature sperm; ICR pseudopregnant female mice were used for embryo transfer.
[0084] Main experimental instruments: micro operating system, stereo microscope, CO 2 Incubators, embryo transfer related equipment, etc.
[0087] For the specific operation steps involved in the Past-CRISPR method and the genotype identification of embryos and fetuses in the experiment, please refer to the above "main operation steps". Genotype identification was determined by comparing the Sanger sequencing results with Snapgene software.
[0088] sgRNAs used:
[0089] Mash2 TGGGCCCCTGCTACGAGTTCTGG SEQ ID NO: 13 Peg10 CAGACGTCTGATCTTGCGTTTGG ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to an allelic specific site editing method which comprises the following steps of: 1, taking MII-period oocytes to divide into two groups, carrying out micro-injection of Cas9 mRNA and sgRNA of a targeted interest gene on the first group, and not carrying out any processing on the second group; 2, simultaneously carrying out in vitro fertilization on two groups of MII oocytes; 3, when an embryo approximately grows to a PN3-4 period of oosperm, respectively taking out male and female pronuclei of the oosperm in the injected group by utilizing a micromanipulation method ofpronucleus interchange, then dividing the oosperm in the unprocessed group into two groups, removing female pronuclei of the oosperm in one group, removing male pronuclei of the oosperm in the other group, and then respectively fusing the male and female pronuclei respectively taken out of the injected group into the oosperm in the unprocessed group, the single pronuclei of which are discarded; and 4, placing the operated embryo into an incubator to wait for sufficient recovery of the embryo so as to form a new recombinant embryo. The allelic specific site editing method implements Cas9 activecontrol and monoallelic site editing, and the application range of gene editing is expanded.
Description
technical field [0001] The present invention relates to the field of biotechnology, in particular to a gene editing method, in particular to an allele-specific site editing method. Background technique [0002] The establishment of the CRISPR-Cas9 gene knockoutsystem greatly simplifies the operation process of gene editing and has high efficiency. It has had a profound impact on the development of biotechnology, medicine and other fields. CRISPR-Cas9 can specifically recognize genomic sequences and induce double-strand breaks (DSBs) under the guidance of sgRNA in vivo or in vitro. At this time, the repair pathway of non-homologous end joining (NHEJ) is mainly activated, and the insertion or deletion of small fragments randomly introduced at the break site leads to frameshift mutation of the coding sequence. Taking advantage of the relatively high repair efficiency of NHEJ, co-injection of Cas9 mRNA and sgRNA targeting target genes in fertilized eggs can effectively generat...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More