miRNA expression vector and its application
An expression vector and DNA sequence technology, applied in the field of miRNA expression vector, can solve the problems of limited tumor cell growth, limited application, and reduced oxygen consumption of glioma cells.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] 1. Provide the mitochondrial positioning sequence. The sequence selected in this embodiment is the coding sequence of the mitochondrial DNA coding gene COX8, and the stop codon is removed. The sequence is shown in SEQ ID NO:4.
[0053] 2. Connect the mitochondrial localization sequence (COX8) to the non-coding RNA expression vector pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO.
[0054] The fragment was synthesized according to the sequence of COX8, a PCR with restriction site was designed, PCR amplification was carried out by high-fidelity enzyme (M0531L, NEB Company), and a plasmid with pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO was obtained. The COX8 sequence of the complementary sequence, after the PCR is completed, use the TAKARA DNA Fragment Purification Kit (Catalog No.: 9761) to purify (see the kit manual for details on the purification steps).
[0055] PCR reaction system:
[0056]
[0057] PCR reaction conditions:
[0058]
[0059] Purification is carried out after PCR is ...
Embodiment 2
[0142] The method of this example is basically the same as that of Example 1, the difference is that the mature body triplet of miR-92b-5p is replaced by the mature body triplet of miR-25-5p or miR-34a-5p, and the operation steps remain unchanged. into corresponding mitochondria-specific miRNA overexpression vectors. The result is as Figures 12 to 17 As shown, miR-25-5p or miR-34a-5p was successfully directional and significantly expressed in the mitochondria of host cells.
[0143] The mature body sequence of miR-25-5p is:
[0144] AGGCGGAGACTTGGGCAATTG
[0145] The mature body sequence of miR-34a-5p is:
[0146] TGGCAGTGTCTTAGCTGGTTGT
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



