Unlock instant, AI-driven research and patent intelligence for your innovation.

miRNA expression vector and its application

An expression vector and DNA sequence technology, applied in the field of miRNA expression vector, can solve the problems of limited tumor cell growth, limited application, and reduced oxygen consumption of glioma cells.

Active Publication Date: 2022-03-01
GUANGZHOU WOMEN AND CHILDRENS MEDICAL CENTER
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mitochondrial hyperpolarization in glioma cells is reversed by the small molecule oral dichloroacetic acid, resulting in tumor cell growth restriction
Tricyclic antidepressants can promote the reduction of oxygen consumption, the release of cytochrome C, and the induction of apoptosis in glioma cells, but their application is limited due to their side effects
[0005] In order to further study the function of miRNA in mitochondria in glioblastoma, it is necessary to overexpress miRNA in glioblastoma mitochondria, but the existing commercial vectors and the vectors reported in the literature cannot be effectively realized.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNA expression vector and its application
  • miRNA expression vector and its application
  • miRNA expression vector and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] 1. Provide the mitochondrial positioning sequence. The sequence selected in this embodiment is the coding sequence of the mitochondrial DNA coding gene COX8, and the stop codon is removed. The sequence is shown in SEQ ID NO:4.

[0053] 2. Connect the mitochondrial localization sequence (COX8) to the non-coding RNA expression vector pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO.

[0054] The fragment was synthesized according to the sequence of COX8, a PCR with restriction site was designed, PCR amplification was carried out by high-fidelity enzyme (M0531L, NEB Company), and a plasmid with pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO was obtained. The COX8 sequence of the complementary sequence, after the PCR is completed, use the TAKARA DNA Fragment Purification Kit (Catalog No.: 9761) to purify (see the kit manual for details on the purification steps).

[0055] PCR reaction system:

[0056]

[0057] PCR reaction conditions:

[0058]

[0059] Purification is carried out after PCR is ...

Embodiment 2

[0142] The method of this example is basically the same as that of Example 1, the difference is that the mature body triplet of miR-92b-5p is replaced by the mature body triplet of miR-25-5p or miR-34a-5p, and the operation steps remain unchanged. into corresponding mitochondria-specific miRNA overexpression vectors. The result is as Figures 12 to 17 As shown, miR-25-5p or miR-34a-5p was successfully directional and significantly expressed in the mitochondria of host cells.

[0143] The mature body sequence of miR-25-5p is:

[0144] AGGCGGAGACTTGGGCAATTG

[0145] The mature body sequence of miR-34a-5p is:

[0146] TGGCAGTGTCTTAGCTGGTTGT

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a miRNA expression vector and its application. The miRNA expression vector has the following elements in sequence from the 5' end to the 3' end: a first promoter, a target sequence, a second promoter and a mitochondrial localization sequence, the target The sequence is obtained by repeating the DNA sequence of the miRNA to be expressed multiple times. It has been proved by experimental tests that, compared with known vectors, the miRNA expression vector of the present application can make the miRNA to be expressed significantly expressed in the mitochondria of the host cell, thereby helping to regulate the expression of miRNA in the mitochondria and realize the regulation of mitochondrial function. Provide a basis for the development of drugs targeting mitochondria.

Description

technical field [0001] The invention relates to the technical field of biochemical molecules, in particular to a miRNA expression vector and its application. Background technique [0002] Mitochondria are organelles with a double-membrane structure in the cytoplasm, and are the place where cells synthesize ATP by oxidative phosphorylation. Mitochondria are involved in the regulation of eukaryotic cell differentiation, energy metabolism, signal transduction, calcium ion homeostasis, reactive oxygen species generation, apoptosis and aging. [0003] Glioma is the most common nervous system tumor, which can be divided into grades I-IV according to the WHO classification, among which glioblastoma (grade IV) is the most malignant. Chemotherapy, radiotherapy and surgery have little effect on improving the survival rate and reducing the mortality rate of glioma, especially glioblastoma. Mitochondrial dysfunction in glioma includes structural abnormalities, changes in mitochondrial...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C12N1/21C12N15/113A61K31/713A61P35/00C12R1/19
CPCC12N15/70C12N15/113A61K31/713A61P35/00C12N2310/141
Inventor 刘晓萍罗霭玲徐令江华刘晓丹杨旭蔡蔓斯
Owner GUANGZHOU WOMEN AND CHILDRENS MEDICAL CENTER