Unlock instant, AI-driven research and patent intelligence for your innovation.

Double-sgRNA traceless gene editing plasmid as well as preparation method and application thereof

A gene editing and plasmid technology, applied in the field of gene editing, can solve the problems of inability to efficiently transfect host cells, numerous components, complex structure, etc., and achieve the effects of improving the efficiency of seamless editing, reducing costs, and being easy to operate.

Pending Publication Date: 2020-09-04
SUZHOU HONGXUN BIOTECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the circular vector has a complex structure and many components, and there is a problem that it cannot be efficiently transfected into host cells
[0006] CN110628798A discloses Bacillus subtilis CRISPR-Cas9 genome editing system, the construction method of this system is: 1) construction plasmid pBSCas9; 2) construction plasmid pDonor; 3) auxiliary plasmid pHG in construction multi-site gRNA expression process; 4) by pBSCas9 , pDonor and pHG constitute the Bacillus subtilis CRISPR-Cas9 genome editing system, but there are many plasmids in this gene editing system, and there is a problem that it cannot be efficiently transfected into host cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-sgRNA traceless gene editing plasmid as well as preparation method and application thereof
  • Double-sgRNA traceless gene editing plasmid as well as preparation method and application thereof
  • Double-sgRNA traceless gene editing plasmid as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1 Construction of Double sgRNA Scarless Gene Editing Plasmid

[0067] In this example, the construction of a double sgRNA scarless gene editing plasmid of Saccharomyces cerevisiae was first carried out.

[0068] (1) Design 3 gene-editing sgRNA1 targeting Saccharomyces cerevisiae ADE1 and 3 gene-editing sgRNA2 targeting Cas9 protein, the sequences of which are as follows:

[0069] sgRNA1-1 (SEQ ID NO: 1): ACTTTACCTCTGGCCACCAA;

[0070] sgRNA1-2 (SEQ ID NO: 2): ACTCTGACAGTTTGGTCAAT;

[0071] sgRNA1-3 (SEQ ID NO:3): TATGTCTTAACTTTTACCTC;

[0072] sgRNA2-1 (SEQ ID NO:4): AATTCTGGTTTCGTACAAAC;

[0073] sgRNA2-2 (SEQ ID NO: 5): GTATCTCTTTCTGTCAATGG;

[0074] sgRNA2-3 (SEQ ID NO: 6): AACAGCCCAACCAACAGAGT;

[0075] (2) According to the designed sgRNA, design a pair of forward and reverse primers for synthesizing the coding sequence of sgRNA1 and a pair of forward and reverse primers for synthesizing the coding sequence of sgRNA2, add 40bp vector homology arms at bo...

Embodiment 2

[0089] Example 2 Saccharomyces cerevisiae traceless gene editing

[0090] Saccharomyces cerevisiae traceless gene editing process such as figure 2 As shown, the schematic diagram is as image 3 As shown, the steps are as follows:

[0091] (1) Mix the double sgRNA traceless gene editing plasmid constructed in Example 1 and Saccharomyces cerevisiae competent cells evenly, set up the electrotransformation program, and electroporate the traceless gene editing plasmid through a BioRad GenePulser cuvette (the distance between electrodes is 0.2cm). Transformed into Saccharomyces cerevisiae competent cells, the duration of electric shock was 5ms;

[0092] (2) After electroporation, Saccharomyces cerevisiae cells were inoculated in 1 mL of 1 M sorbitol:YPD (1:1) medium, cultured in suspension at 30°C for 1 hour, collected cells were inoculated on a plate without screening markers, and incubated at 30°C Cultivate for 3 days;

[0093] (3) Observe the color change of the colony, such...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a double-sgRNA traceless gene editing plasmid as well as a preparation method and application thereof. The plasmid comprises a Cas9 protein expression cassette and a double-sgRNA expression cassette, wherein the double-sgRNA expression cassette comprises host gene editing sgRNA and plasmid gene editing sgRNA. The plasmid containing the double-sgRNA is designed to perform gene editing on a host, one sgRNA of the double-sgRNA is used for performing gene editing on the host, and the other sgRNA is used for eliminating the plasmid, so that the aim of eliminating the gene editing plasmid while performing gene editing on the host is achieved, the off-target rate is not increased due to continuous expression of Cas9 protein, and subsequent experiments are not influenced. The plasmid is transformed into saccharomyces cerevisiae for gene editing, so that the traceless editing efficiency of the saccharomyces cerevisiae is obviously improved.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and relates to a double sgRNA traceless gene editing plasmid and its preparation method and application, in particular to a CRISPR / Cas9-based double sgRNA traceless gene editing plasmid and its preparation method and the gene editing method in Saccharomyces cerevisiae Transformation, Saccharomyces cerevisiae gene function research and application in strain improvement. Background technique [0002] Once CRISPR / Cas9 technology came out, it became the focus of attention in the biological field. CRISPR / Cas9 technology mainly includes two elements: the Cas9 protein that cuts the double strand of DNA and the sgRNA that recognizes the target site. The specific gRNA guides the Cas9 protein to cut the double-strand DNA at the target site, resulting in a DNA double-strand break. Repair, realize gene knockout or insertion, and achieve the purpose of gene editing. CRISPR / Cas9 gene editing technology...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/90C12R1/865
CPCC12N15/81C12N15/905
Inventor 朱佑民程倩王梓旭陶小倩杨平柳伟强邢妍婧赵一凡
Owner SUZHOU HONGXUN BIOTECH CO LTD