Construction method and application of annular RNA overexpression system for protoplast of secondary xylem of poplar

A protoplast and construction method technology, applied in the field of genetic engineering, can solve the problems of low genetic transformation efficiency and long cycle, and achieve the effect of simple and fast construction method

Active Publication Date: 2019-03-19
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to solve the problem of low efficiency and long cycle of genetic transformation, the method of transforming protoplasts can achieve stable expression after only 12 h of cultivation, and then study the effect of overexpression of circular RNA on gene expression and post-transcriptional regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of annular RNA overexpression system for protoplast of secondary xylem of poplar
  • Construction method and application of annular RNA overexpression system for protoplast of secondary xylem of poplar
  • Construction method and application of annular RNA overexpression system for protoplast of secondary xylem of poplar

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Extraction of poplar nucleic acid

[0038] (1) Material handling

[0039] Select 6 Populus trichocarpa growing healthily at the age of 3-9 months, use the xylem below the seventh leaf on the upper end of the morphology and above the soil surface at the lower end as materials, scrape the secondary xylem with a scalpel after peeling, and put it in Put them in the tin foil that has been marked in advance, and immediately put them in liquid nitrogen for quick freezing. Use a high-throughput tissue disruptor (QIAGEN TissueLyser II) to grind the xylem material into a powder sample, mix it, put it in an RNase-free 50 mL tube (corning), and store it in a -80°C refrigerator for a long time.

[0040] (2) Extraction of xylem Genomic DNA and Total RNA

[0041] Aliquot 120 mg of the powder samples obtained from the treatment of the above materials into 1.5 mL RNase-free tubes, use the PlantGenomic DNA Kit (TIANGEN, no. DP305, China) to extract the Genomic DNA of the xyle...

Embodiment 2

[0044] Example 2 Molecular biological verification of circular RNA

[0045] Through transcriptome sequencing, 13 circular RNA genes were obtained, the sequences of which are shown in SEQ ID NO: 1 to SEQ ID NO: 13. In order to verify the authenticity of the circular RNA, PRAPI software was used to design "back-to-back" primers ( figure 1 ), verified by PCR amplification and sequencing experiments, and the primer sequences are shown in Table 2.

[0046] Take 20 μg Total RNA (54 μL) and divide it equally into two 1.5 mL RNase-free centrifuge tubes, one for RNase R digestion and the other for control. Next, add 3.1 μL 10×RNaseR Reaction Buffer and 1 μL RNase R (20U / uL) to both the treatment tube and the control tube in sequence (in the control tube, 1 μL RNase-free water was used instead of RNase R), mix well, microcentrifuge, and place in a water bath Incubate at 37°C for 10 min. Then, add 30 μL of phenol-chloroform-isoamyl alcohol=25:24:1 to terminate the enzyme digestion rea...

Embodiment 3

[0050] Example 3 Construction of circular RNA overexpression vector

[0051] (1) A band containing the upstream and downstream endogenous flanking sequences of the host gene attB- Frame acquisition of linker sequences

[0052] The partial sequence of the host gene of Potri.004G162600 (Chr04:18369599-18370055) was selected as the target gene. Design 5' end band attB- site linkers, and primers that include the endogenous flanking sequences of the gene of interest ( image 3 ). The primer sequences are as follows:

[0053] The forward primer is, SEQ ID NO:44:

[0054] Ptr-trans-130-F:5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTT

[0055] CGTATATGCAGGCCTGTCTTTGCT-3'

[0056] The reverse primer is, SEQ ID NO:45:

[0057] Ptr-trans-130-R:5'- GGGGACCACTTTGTACAAGAAAGCTGGGTC

[0058] CTAAACAGAAGACGGACACAATTTTGT-3'

[0059] The underlined part is the recognition site of Gateway, namelyattB- recognition site.

[0060] 200 ng Genomic DNA as a template, 2.5 μL each of the above forward...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of an annular RNA overexpression system for a protoplast of a secondary xylem of a poplar, belonging to the technical field of genetic engineering. The construction method comprises the following steps: carrying out molecular biological verification on annular RNA; constructing an overexpression recombinant plasmid of annular RNA; converting the protoplast of the poplar by virtue of a PEG-mediated recombinant plasmid; and carrying out molecular biological detection on the overexpression condition of annular RNA in the protoplast ofthe converted recombinant plasmid. The overexpression system can be applied to the regulation and control of the expression condition after the transcription of a host gene.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a construction method and application of a circular RNA overexpression system in poplar secondary xylem protoplasts. Background technique [0002] Circular RNA is a type of non-coding RNA that has attracted widespread attention from scientists in recent years, and it is also the latest research hotspot in the RNA field. According to the different splicing sources of circular RNA, it can be divided into circular RNA formed by exon circularization, circular RNA formed by intron circularization, and exon obtained by retaining intron in the middle of circularized exon. The sub-intron circular RNA is different from the traditional linear RNA (linear RNA, including 5' and 3' ends). The circular RNA has a closed circular structure and is not affected by RNA exonucleases. The expression is more stable and difficult to There are many types of degradation, and some...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82
CPCC12N15/8241
Inventor顾连峰刘旭庆高宇帮王慧慧王永生席飞虎张泽宇徐锡张航晓赵良真
OwnerFUJIAN AGRI & FORESTRY UNIV