Human interleukin-2 variant or derivative thereof

A technology of interleukin and derivatives, applied in the direction of microorganisms, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of lack of regulatory T cell activation level and reduced IL-2 variants

Inactive Publication Date: 2020-09-11
JIANGSU HENGRUI MEDICINE CO LTD +2
View PDF11 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, IL-2 variants with higher stability, reduced activation of regulatory T cells, and unaffected activation of immune effector cells are still lacking in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human interleukin-2 variant or derivative thereof
  • Human interleukin-2 variant or derivative thereof
  • Human interleukin-2 variant or derivative thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0159] Embodiment 1: the construction and expression of wild-type IL-2 and variant

[0160] 1. Gene synthesis and recombinant expression vector construction

[0161] The wild-type IL-2 nucleic acid sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0162] The synthetic wild-type IL-2 nucleic acid sequence is shown in SEQ ID NO: 1, an Nde I restriction site is added at the 5' end, and a BamH I restriction site is added at the 3' end. The nucleotide sequence is as follows:

[0163] CATATGGCACCGACCAGCAGCAGCACCAAAAAAACCCAGCTGCAACTGGAACATCTGCTGTTAGATCTGCAAATGATTCTGAACGGCATCAACAACTACAAAAATCCGAAACTGACCCGTATGCTGACCTTCAAATTCTACATGCCGAAAAAAGCAACCGAGCTGAAACATCTGCAGTGTCTGGAAGAAGAACTGAAACCGCTGGAAGAGGTTCTGAATCTGGCACAGAGCAAAAACTTTCATCTGCGTCCGCGTGATCTGATTAGCAATATTAACGTTATTGTGCTGGAACTGAAAGGTAGCGAAACCACCTTTATGTGTGAATATGCCGATGAAACCGCAACCATTGTGGAATTTCTGAATCGTTGGATTACCTTTTGTCAGAGCATTATTAGCACCCTGACCTAATGAGGATCC

[0164] SEQ ID NO: 1

[0165] The parts in italics are NdeI and...

Embodiment 2

[0289] Embodiment 2: wild-type IL-2 and variants and interleukin 2 receptor alpha (IL-2Rα) binding force determination

[0290] The binding properties of IL-2 and its mutants prepared in Example 1 to IL-2Rα were detected by ELISA experiment. The his-tagged IL-2Rα recombinant protein was coated, and after adding IL-2, the antibody-antigen binding activity was detected by adding HRP-coupled anti-IL-2 polyclonal antibody and HRP substrate TMB.

[0291] A 96-well ELISA plate was coated with 2 μg / mL his-tagged IL-2Rα recombinant protein (SinoBiological, Cat#10165-H08H) and incubated overnight at 4°C. Wash three times with washing solution, 250 μl per well. Shake for 10 seconds per wash to ensure thorough cleaning. Add 200 μl / well blocking solution and incubate at room temperature for 2 hours. Wash three times with washing solution, 250 μl per well. Shake for 10 seconds per wash to ensure thorough cleaning. Add 100 μl of IL-2 and its mutants diluted with diluent to each well. ...

Embodiment 3

[0297] Embodiment 3: wild-type IL-2 and variants and IL-2 receptor beta / gamma (IL-2Rβ / γ) binding assay Biacore experiment is used to detect IL-2 and mutants thereof and IL-2 in embodiment 1 IL-2Rβ / γ binding.

[0298] First, IL-2Rβ and IL-2Rγ subunits (SEQ ID NO: 41 and 42) were cloned and fused to Fc hole and Fc knob, respectively, for the preparation of tool molecule IL-2Rβ / γ-Fc heterodimer . IL-2Rβ-Fc-hole and IL-2Rγ-Fc-knob were simultaneously transfected into HEK293 cells. The heterodimer was purified with Protein A and molecular sieve Superdex 200 successively.

[0299] MDMRVPAQLLGLLLLWFPGARCAVNGTSQFTCFYNSRANISCVWSQDGALQDTSCQVHAWPDRRRWNQTCELLPVSQASWACNLILGAPDSQKLTTVDIVTLRVLCREGVRWRVMAIQDFKPFENLRLMAPISLQVVHVETHRCNISWEISQASHYFERHLEFEARTLSPGHTWEEAPLLTLKQKQEWICLETLTPDTQYEFQVRVKPLQGEFTTWSPWSQPLAFRTKPAALGKDTGAQDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVCTLPPSRDELTKNQVSLSCAVKGFYPSDIAVEWESNGQPE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a human interleukin-2 variant or a derivative thereof, in particular to IL-2 with one or more mutant amino acids or a derivative of the IL-2 with one or more mutant amino acids. The human interleukin-2 variant or the derivative thereof has eliminated or reduced affinity with a high-affinity receptor (IL-2Ralpha / beta / gamma), and the affinity with a medium-affinity receptor(IL-2Rbeta / gamma) is kept. According to the human interleukin-2 variant or the derivative thereof, a good basis is provided for protein patent medicines.

Description

technical field [0001] The present disclosure relates to human interleukin-2 (IL-2) variants or derivatives thereof having one or more amino acid mutations. The IL-2 variants or derivatives have abolished or reduced affinity for high affinity receptors (IL-2Rα / β / γ) and retain affinity for intermediate affinity receptors (IL-2Rβ / γ). The present disclosure also relates to immunoconjugates, encoding polynucleotides, vectors, host cells, pharmaceutical compositions, preparation methods, and treatment methods and uses comprising the human IL-2 variants or derivatives thereof. Background technique [0002] Human interleukin-2 (interleukin-2, IL-2), also known as T cell growth factor (TCGF), the gene is located on chromosome 4 (4q27), including a total of 7kb sequence, consisting of 133 amino acids, with a molecular weight of about 15kD. In 1976 and 1977, Doris Morgan, Francis Ruscetti, Robert Gallo, Steven Gillis, and Kendal Smith found that activated T cell culture medium could...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/55C12N15/70C12N1/21A61K38/20A61K47/68A61P35/00A61P35/04A61P37/02A61P37/04C12R1/19
CPCA61K38/2013A61K47/6813A61P35/00A61P35/04A61P37/02A61P37/04C07K14/55C12N15/70
Inventor陈磊胡齐悦葛虎林源王宏伟欧阳超孔祥林廖成张连山
OwnerJIANGSU HENGRUI MEDICINE CO LTD