sgRNA for specifically recognizing pig AP2 site and application of sgRNA
A specific recognition and species-specific technology, applied in the field of genetic engineering, can solve the problems of inaccurate repair and loss of gene function, and achieve the effect of strong specificity and reducing off-target phenomena.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Construction of sgRNA expression plasmids.
[0040] A sequence encoding sgRNA upstream of the stop codon of the porcine AP2 gene (GI: 399533) was selected, as shown in SEQ ID NO.2, specifically: ATGTATCATGAAAGGTGTCA, named AP2-sgR.
[0041] Extract the coding region of the AP2 gene, and the target position is as follows (the underline is the guide sequence AP2-sgR):
[0042]
[0043] Add G to the 5' end of the above-mentioned guide sequence AP2-sgR to obtain a forward oligonucleotide, and add C to the 3' end of its complementary sequence to obtain a reverse oligonucleotide, and the oligonucleotide chains to be synthesized were respectively Named AP2-sgR-F (shown in SEQ ID NO.3) and AP2-sgR-R (shown in SEQ ID NO.4), the sequences are shown in the table below, and the underlined part is the restriction site:
[0044] sequence name Sequence (5'-3') AP2-sgR-F accg GATGTATCATGAAAGGTGTCA
AP2-sgR-R aaac TGACACCTTTCATGATACATC
[0045...
Embodiment 2
[0049] Efficiency verification of sgRNA expression plasmids.
[0050] (1) Nucleofection
[0051] The recombinant plasmid pgl3-AP2-sgR obtained in Example 1 was transfected into 3D4-Cas9 cell line by liposome transfection, the specific operation process is as follows:
[0052] The day before the transfection, the 3D4-Cas9 cell line was inoculated into a 6-well culture dish, and the transfection was performed when the cell density reached about 80% on the second day, and the operation was performed according to the operation manual of lipo2000 (Invitrogen). After 24 hours of transfection, the fluorescence can be observed. After 48 hours of transfection, cells with GFP fluorescence were sorted by flow cytometry.
[0053] (2) Cell Genomic DNA Extraction
[0054] Collect the cells obtained by the above sorting into EP tubes, and extract the genomic DNA of the cells. The specific operation process is as follows:
[0055] ① Add 200uL buffer GA to the EP tube containing the cell pe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


