Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SNP locus, primer group and method for identifying cauliflower variety Zhejiang Nongsong 80-day

A cauliflower and primer set technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve problems such as long investigation cycle, achieve high practical value, accurate identification, and shorten the identification cycle effect

Active Publication Date: 2020-10-02
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a SNP site, primer set and method for identifying the cauliflower "Zhe Nong Song Hua 80 days", which solves the problem of long traditional phenotype investigation period, and can efficiently and accurately identify the cauliflower "Zhe Nong Song Hua 80 days". Nongsonghua 80 days" variety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP locus, primer group and method for identifying cauliflower variety Zhejiang Nongsong 80-day
  • SNP locus, primer group and method for identifying cauliflower variety Zhejiang Nongsong 80-day
  • SNP locus, primer group and method for identifying cauliflower variety Zhejiang Nongsong 80-day

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] A method for identifying the purity of cauliflower "Zhenong Songhua 80 days" by KASP labeling, using the above-mentioned KASP labeling primer set, adding a specific sequence that can bind to FAM fluorescence at the 5' end of SNP-specific primers X and X' (SEQ ID. NO 7: GAAGGTGACCAAGTTCATGCT), the 5' end of the SNP-specific primer Y and Y' added a specific sequence that can be combined with HEX fluorescence (SEQ ID. NO 8: GAAGGTCGGAGTCAACGGATT), the identified materials are: "Zhenong Songhua 80 days" 2 male parents, 2 female parents and samples. The samples are 98 true hybrids of "Zhenong Songhua 80 days" and 4 artificial hybrid materials. The method is as follows:

[0046] (1) Extraction of genomic DNA

[0047] Genomic DNA was extracted from the “Zhenong Songhua 80 Days” hybrid and its parents using the traditional CTAB method, as follows:

[0048] Take 0.1 g of the young leaves of the plants to be selected, put them into a 2.0 mL flat-top centrifuge tube, add 600 μL o...

Embodiment 2

[0057] Authenticity identification of hybrids harvested in the field of embodiment 2

[0058] "Zhe Nong Songhua 80 days" has 1 male parent and 1 female parent, and 208 hybrids were harvested that year. These materials were raised in plug trays on July 15, 2019, and transplanted into the field on August 15, 2019. From October 15 to November 15, 2019, the agronomic traits such as leaf shape, plant shape and ball shape of 208 materials were tested. Observe, and compare with the parent material of father and mother, determine the number of hybrids and the purity of the sample to be tested, and identify by the method of Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP locus, a primer group and a method for identifying a cauliflower variety Zhejiang Nongsong 80-day. A KASP labeled primer group aims at the SNP locus and a flanking sequence thereof, wherein a ZWSNP_119 primer group comprises a primer X of a nucleotide sequence shown in SEQ ID. NO. 1, a primer Y of a nucleotide sequence shown in SEQ ID. NO. 2 and a universal primer Rof a nucleotide sequence shown in SEQ ID. NO. 3; and a ZWSNP_162 primer group comprises a primer X' of a nucleotide sequence shown in SEQ ID. NO. 4, a primer Y' of a nucleotide sequence shown in SEQ ID. NO. 5 and a universal primer R' of a nucleotide sequence shown in SEQ ID. NO. 6. The primer group disclosed by the invention is used for identifying the cauliflower variety Zhejiang Nongsong 80-day, is efficient, accurate and short in period and has a very high practical value.

Description

technical field [0001] The invention relates to a KASP marker primer set, in particular to a SNP site, a primer set and a method for identifying the cauliflower "Zhenong Songhua 80 days". Background technique [0002] In recent years, the market share of cauliflower varieties independently bred in my country has gradually increased, and the demand for seeds has a huge potential. The heterosis of cauliflower is obvious, and almost all the varieties selected are F 1 generation hybrids. However, in the process of hybrid seed production, due to pollination by agricultural operations, long-distance pollination by insects such as bees and flies will cause false hybrids; , resulting in a small amount of self-seeds of the female parent in the hybrids, which will easily cause the loss of parents while forming pseudo-hybrids; the difference in seed morphology among cauliflower varieties is small, which is likely to cause mechanical mixing. [0003] At present, the identification of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2563/107
Inventor 盛小光赵振卿顾宏辉王建升虞慧芳沈钰森
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com