Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific primer pair for rapidly detecting Enterocytozoon hepatopenaei by utilizing RPA-LFS, detection kit and application of detection kit

A detection kit and technology of Enterocystoma hepatica, applied in the field of detection, can solve problems such as complex primer system, insufficient system stability, and dependence on turbidity determination

Inactive Publication Date: 2020-11-24
JIANGSU OCEAN UNIV +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Including nested PCR, real-time fluorescent quantitative PCR method, this kind of detection technology needs to rely on temperature control equipment and professional technicians, suitable for laboratory environment, and the promotion area is limited; in addition to LAMP technology, this technology It can be carried out under constant temperature conditions, but the primer system is complex and prone to false positives, and the result verification depends on agarose gel electrophoresis or sample turbidity
The result of agarose gel electrophoresis shows a ladder-shaped band, which cannot be ruled out due to the formation of primer-dimers; the judgment of turbidity depends on subjective judgment, and it is impossible to judge whether the sample is turbid due to the amplification of primer-dimers, and the system is stable sexual insufficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer pair for rapidly detecting Enterocytozoon hepatopenaei by utilizing RPA-LFS, detection kit and application of detection kit
  • Specific primer pair for rapidly detecting Enterocytozoon hepatopenaei by utilizing RPA-LFS, detection kit and application of detection kit
  • Specific primer pair for rapidly detecting Enterocytozoon hepatopenaei by utilizing RPA-LFS, detection kit and application of detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some of the embodiments of the present invention, not all of them.

[0030] In describing the present invention, it should be understood that the terms "upper", "lower", "front", "rear", "left", "right", "top", "bottom", "inner", " The orientation or positional relationship indicated by "outside", etc. is based on the orientation or positional relationship shown in the drawings, and is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the referred device or element must have a specific orientation, so as to Specific orientation configurations and operations, therefore, are not to be construed as limitations on the invention.

[0031] In...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a specific primer pair for rapidly detecting Enterocytozoon hepatopenaei by utilizing RPA-LFS, a detection kit and application of the detection kit. The detection kit comprisesthe specific primer pair and a probe, wherein an upstream primer is ACAATTTCAAACACTGTAAACCTTAAAGCA, a downstream primer is Bioten-TCATTCATTTTCCTTTTATCTTCTGATATG, and the probe is FITC-TAAAAAGAGACGATATTTACACAGACACAG[THF]ATTTGTAGGATATGA-C3Spacer. According to the specific primer pair, the detection kit and the application, disclosed by the invention, the Enterocytozoon hepatopenaei (Ehp) can be rapidly detected on site under a room-temperature environment through the RPA-LFS, a traditional long-time high-temperature detection method that a nest needs to depend on temperature control equipment is avoided, a result can be judged and read by naked eyes, more convenience is obtained, and the detection kit is suitable for diagnosing aquaculture animal diseases.

Description

technical field [0001] The invention relates to the technical field of detection, in particular to a pair of specific primers, a detection kit and an application thereof for rapid detection of Enterocystoma hepatica using RPA-LFS. Background technique [0002] E. hepatica was first discovered in P. monodon in Thailand in 2009, and then gradually found in other prawns. Unlike other microsporidia that cause obvious symptoms such as whitening of the juvenile shrimp muscles, E. hepatica infecting shrimp does not cause significant symptoms, and it is difficult to observe with the naked eye in the early stage. However, Ehp can cause severe growth retardation of juvenile shrimp, which is very important for farmers. cause huge economic losses. At present, it has been confirmed that the transmission mode of Ehp mainly includes horizontal transmission, and can be transmitted through cannibalism and through feces. However, there are currently no effective preventive measures. Theref...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6893C12Q1/6844C12Q1/04C12N15/11
CPCC12Q1/6844C12Q1/6893C12Q2531/119C12Q2521/507C12Q2522/101C12Q2537/1376C12Q2563/107C12Q2565/625Y02A50/30
Inventor 董井泉董宇高嵩赵盼盼杨潇含俞海怡
Owner JIANGSU OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products