Maize multi-copper oxidase coding gene zmdek559-2 and its application

An oxidase coding, corn technology, applied in the fields of plant bioengineering breeding and molecular biology, to achieve broad application prospects, good growth, and the effect of promoting the formation of crop yields

Active Publication Date: 2022-03-22
SHANDONG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After searching, there are no reports about the maize multi-copper oxidase gene ZmDEK559-2 and its application in improving crop yield under adversity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Maize multi-copper oxidase coding gene zmdek559-2 and its application
  • Maize multi-copper oxidase coding gene zmdek559-2 and its application
  • Maize multi-copper oxidase coding gene zmdek559-2 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1: Cloning of maize multi-copper oxidase coding gene ZmDEK559-2

[0044] 1) According to the sequence number Zm00001d043090 of the ZmDEK559-2 gene, the maize MaizeGDB database (https: / / www.maizegdb.org / ) was searched to obtain the cDNA sequence of the gene, which was used for primer design and screening of the gene clone.

[0045] 2) According to the above sequence, use PRIMER5.0 software to design PCR amplification primers.

[0046] The upstream primer is 5'TATAAGCCGTGGCCTCCC 3';

[0047] The downstream primer is 5'CTGACCATCGCCTCTTAATTT 3'.

[0048] 3) Take the leaves of Maize Qi 319 seedlings, grind them in liquid nitrogen, and extract RNA with RNAisoPlus (Takara DaLian), a plant total RNA extraction kit. Take 500 ng of total RNA, and follow the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian) kit. Reverse transcription was performed to obtain its cDNA template for cloning of the ZmDEK559-2 gene.

[0049] The reaction system is as follows:

...

Embodiment 2

[0053] Example 2: Construction of recombinant vector for ZmDEK559-2 expression driven by maize Ubiquitin1 promoter and transformation of Escherichia coli and Agrobacterium

[0054] 1) Based on the cDNA sequence of the above clone, use primer5.0 software to design upstream and downstream primers, and at the same time introduce SacI restriction sites at both ends to obtain base sequences containing SacI restriction sites at both ends, so as to facilitate subsequent plasmid recombination .

[0055] 2) The primer sequences are as follows:

[0056] Upstream primer: 5'-GGAGCTCATGGTGTGGTCGGCTGGGAT-3'

[0057] Downstream primer: 5'-GGAGCTCCTAGACGGAGAGGTAGGACGG-3'

[0058] 3) Using the plasmid containing the ZmDEK559-2 cDNA sequence as a template, PCR amplification obtains the CDS nucleotide sequence with SacI restriction sites at both ends, its CDS sequence is shown in SEQ ID No.1, and the amino acid encoded by it is The sequence is shown as SEQ ID No.2. After the PCR product was ...

Embodiment 3

[0067] Example 3: Genetic transformation of maize and acquisition of transgenic plants

[0068] 1) Using the maize inbred line Qi 319 as a material, carry out genetic transformation mediated by Agrobacterium. The seeds germinate after being sterilized, and the shoot tips are cultured in vitro to produce clustered buds, which are finally used as receptors for transformation. The culture medium is as follows:

[0069] Seed germination medium: KI 0.83mg / l, KNO 3 1900mg / l, CaCl 2 2H 2 O 440mg / l, MnSO 4 4H 2 O 22.3 mg / l, KH 2 PO 4 ·H 2 O 170mg / l, H 3 BO 3 10mg / l, CuSO 4 ·5H 2 O 0.025mg / l, FeSO 4 ·7H 2 O27.8mg / l, MgSO 4 ·7H 2 O 370mg / l, NH4NO 3 1650mg / l, ZnSO 4 ·7H 2 O 10mg / l, CoCl 2 ·6H 2 O0.025mg / l, Na 2 MoO 4 2H 2 O 0.5mg / l, pyridoxine hydrochloride 1.0mg / l, inositol 100.0mg / l, thiamine hydrochloride 10.0mg / l, glycine 2.0mg / l, casein hydrolyzate 500mg / l, niacin 1.0mg / l l, sucrose 30g / l, biotin 0.05mg / l, agar powder 7g / l, pH 5.8-6.0, used for seed germi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a maize multi-copper oxidase coding gene ZmDEK559-2. The CDS sequence of the gene is shown in SEQ ID No.1, and the encoded protein sequence is shown in SEQ ID No.2. The invention also discloses the application of the maize polycopper oxidase coding gene ZmDEK559‑2 or the plant expression vector containing the gene in breeding for improving crop tolerance to drought or high-salt adversity stress. Experiments have confirmed that the drought resistance and salt tolerance of maize overexpressing the ZmDEK559‑2 gene have been significantly improved compared with the untransformed wild-type control, and it can maintain relatively good growth when encountering adversity stress such as drought and high salinity, thereby promoting crop growth. The increase in yield indicates that the invention has broad application prospects in crop stress resistance genetic breeding improvement.

Description

technical field [0001] The invention belongs to the technical fields of plant bioengineering breeding and molecular biology, and in particular relates to a corn polycopper oxidase coding gene ZmDEK559-2 and its use in improving crop tolerance to drought or high-salt adversity stress breeding and under adversity applications in increasing crop yields. Background technique [0002] Corn is an important food, feed and energy crop, and occupies an extremely important position in my country's food and energy security system. Population growth, climate change, social and economic growth, development of animal husbandry and depletion of mineral energy have resulted in global food, feed and fuel shortages, especially the rigid growth in demand for corn. At present, with the advancement of urbanization, the area of ​​cultivated land in our country is constantly shrinking, natural disasters occur frequently, and the constraints on food production are becoming increasingly prominent. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/82A01H5/00A01H5/10A01H6/46
CPCC12N9/0063C12N9/0061C12N9/0091C12N15/8273C12Y110/03003C12Y110/03002C12Y116/03001
Inventor李坤朋张珂刘柏妤李文迪张可炜
OwnerSHANDONG UNIV