Maize multi-copper oxidase coding gene zmdek559-2 and its application
An oxidase coding, corn technology, applied in the fields of plant bioengineering breeding and molecular biology, to achieve broad application prospects, good growth, and the effect of promoting the formation of crop yields
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1: Cloning of maize multi-copper oxidase coding gene ZmDEK559-2
[0044] 1) According to the sequence number Zm00001d043090 of the ZmDEK559-2 gene, the maize MaizeGDB database (https: / / www.maizegdb.org / ) was searched to obtain the cDNA sequence of the gene, which was used for primer design and screening of the gene clone.
[0045] 2) According to the above sequence, use PRIMER5.0 software to design PCR amplification primers.
[0046] The upstream primer is 5'TATAAGCCGTGGCCTCCC 3';
[0047] The downstream primer is 5'CTGACCATCGCCTCTTAATTT 3'.
[0048] 3) Take the leaves of Maize Qi 319 seedlings, grind them in liquid nitrogen, and extract RNA with RNAisoPlus (Takara DaLian), a plant total RNA extraction kit. Take 500 ng of total RNA, and follow the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian) kit. Reverse transcription was performed to obtain its cDNA template for cloning of the ZmDEK559-2 gene.
[0049] The reaction system is as follows:
...
Embodiment 2
[0053] Example 2: Construction of recombinant vector for ZmDEK559-2 expression driven by maize Ubiquitin1 promoter and transformation of Escherichia coli and Agrobacterium
[0054] 1) Based on the cDNA sequence of the above clone, use primer5.0 software to design upstream and downstream primers, and at the same time introduce SacI restriction sites at both ends to obtain base sequences containing SacI restriction sites at both ends, so as to facilitate subsequent plasmid recombination .
[0055] 2) The primer sequences are as follows:
[0056] Upstream primer: 5'-GGAGCTCATGGTGTGGTCGGCTGGGAT-3'
[0057] Downstream primer: 5'-GGAGCTCCTAGACGGAGAGGTAGGACGG-3'
[0058] 3) Using the plasmid containing the ZmDEK559-2 cDNA sequence as a template, PCR amplification obtains the CDS nucleotide sequence with SacI restriction sites at both ends, its CDS sequence is shown in SEQ ID No.1, and the amino acid encoded by it is The sequence is shown as SEQ ID No.2. After the PCR product was ...
Embodiment 3
[0067] Example 3: Genetic transformation of maize and acquisition of transgenic plants
[0068] 1) Using the maize inbred line Qi 319 as a material, carry out genetic transformation mediated by Agrobacterium. The seeds germinate after being sterilized, and the shoot tips are cultured in vitro to produce clustered buds, which are finally used as receptors for transformation. The culture medium is as follows:
[0069] Seed germination medium: KI 0.83mg / l, KNO 3 1900mg / l, CaCl 2 2H 2 O 440mg / l, MnSO 4 4H 2 O 22.3 mg / l, KH 2 PO 4 ·H 2 O 170mg / l, H 3 BO 3 10mg / l, CuSO 4 ·5H 2 O 0.025mg / l, FeSO 4 ·7H 2 O27.8mg / l, MgSO 4 ·7H 2 O 370mg / l, NH4NO 3 1650mg / l, ZnSO 4 ·7H 2 O 10mg / l, CoCl 2 ·6H 2 O0.025mg / l, Na 2 MoO 4 2H 2 O 0.5mg / l, pyridoxine hydrochloride 1.0mg / l, inositol 100.0mg / l, thiamine hydrochloride 10.0mg / l, glycine 2.0mg / l, casein hydrolyzate 500mg / l, niacin 1.0mg / l l, sucrose 30g / l, biotin 0.05mg / l, agar powder 7g / l, pH 5.8-6.0, used for seed germi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


