Method for increasing plant cellulose content by utilizing apple fructokinase gene
A technology of plant cellulose and fructokinase, applied in the field of genetic engineering, can solve the problem of ambiguous cellulose biomass in stems
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2021-01-05
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention belongs to the technical field of genetic engineering and relates to an apple fructokinase gene MdFRK2.
[0002] The invention also relates to a recombinant overexpression vector containing the apple fructokinase gene MdFRK2.
[0003] The invention also relates to a method for increasing plant cellulose content by using apple fructokinase gene MdFRK2. Background technique
[0004] The cell wall is one of the important features of plant cells. About 70% of photosynthetic products in nature are converted into polymers and accumulate in cell walls. Cell wall biomass is the most abundant renewable resource on earth (Dominique Loqué et al., 2015). However, the non-renewability of fossil energy has become a major challenge to the sustainable development of mankind. Therefore, exploring how to convert cell wall biomass into usable energy is of great significance to the sustainable development of human society.
[0005] The cell wall structur...
Examples
Embodiment Construction
[0039] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0040] The invention provides an apple fructokinase gene MdFRK2, the nucleotide sequence of which is shown in SEQ ID NO.1:
[0041] SEQ ID NO.1:
[0042] ATGGCTAACAATGGCGTACCGCAGACCGGAAAGGGTATGATCGTGAGTTTCGGCGAGATGCTGATCGACTTCGTCCCCACCGAATCGGGCGTTTCTCTTGCCGAAGCTCCTGGCTTCCTCAAAGCCCCAGGCGGGGCCCCCGCCAACGTGGCGATCGCCGTGGCTCGCCTCGGCGGAAAGGCCGCGTTCGTCGGAAAACTCGGCGACGACGAGTTCGGCCACATGCTCGCCGGCATCCTGAAGAAATACGGCGTCGCTGGAGAAGGCATCTCGTTCGATCAGGGCGCCCGCACCGCCTTGGCCTTCGTGACCCTACGCGCCGACGGTGAACGTGAGTTCATGTTCTACCGGAACCCTAGCGCCGATATGCTGCTGAAGCCCGACGAGCTCAACATCGAGCTCATCAAATCCGCCAAAGTGTTCCACTATGGATCCATTAGCTTGATCGTGGAGCCGTGCAGATCGGCACATCTGAAGGCAATGGAGGTGGCTAAAGAAGCAGGTGCATTGCTCTCCTACGACCCGAACCTCCGGGAGCCGCTGTGGCCGTCGCGGGAAGAGGCAAAGAAGCAGATAATGAGCATATGGGATAAGGCCGATGTGATCAAGGTGAGTGATGTGGAGCTGGAGTTCCTTACAGGGAGCCCCAAGATTGATGATGCCAATGCCATGACACTGTGGAGAGATAGCTTGAAGCTCCT...