Method for increasing plant cellulose content by utilizing apple fructokinase gene

A technology of plant cellulose and fructokinase, applied in the field of genetic engineering, can solve the problem of ambiguous cellulose biomass in stems

CN112175972APending Publication Date: 2021-01-05NORTHWEST A & F UNIV
2 Cites 2 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2021-01-05

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a method for increasing the plant cellulose content by utilizing an apple fructokinase gene. An apple fructokinase gene MdFRK2, a recombinant overexpression vector containing the apple fructokinase gene MdFRK2 and recombinant bacteria containing the apple fructokinase gene MdFRK2 are involved in the method. The apple fructokinase gene MdFRK2 in the method can be used for increasing the cellulose content; and the method plays an important role in cell wall transformation and green energy development.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the technical field of genetic engineering and relates to an apple fructokinase gene MdFRK2.

[0002] The invention also relates to a recombinant overexpression vector containing the apple fructokinase gene MdFRK2.

[0003] The invention also relates to a method for increasing plant cellulose content by using apple fructokinase gene MdFRK2. Background technique

[0004] The cell wall is one of the important features of plant cells. About 70% of photosynthetic products in nature are converted into polymers and accumulate in cell walls. Cell wall biomass is the most abundant renewable resource on earth (Dominique Loqué et al., 2015). However, the non-renewability of fossil energy has become a major challenge to the sustainable development of mankind. Therefore, exploring how to convert cell wall biomass into usable energy is of great significance to the sustainable development of human society.

[0005] The cell wall structur...

Examples

Embodiment Construction

[0039] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0040] The invention provides an apple fructokinase gene MdFRK2, the nucleotide sequence of which is shown in SEQ ID NO.1:

[0041] SEQ ID NO.1:

[0042] ATGGCTAACAATGGCGTACCGCAGACCGGAAAGGGTATGATCGTGAGTTTCGGCGAGATGCTGATCGACTTCGTCCCCACCGAATCGGGCGTTTCTCTTGCCGAAGCTCCTGGCTTCCTCAAAGCCCCAGGCGGGGCCCCCGCCAACGTGGCGATCGCCGTGGCTCGCCTCGGCGGAAAGGCCGCGTTCGTCGGAAAACTCGGCGACGACGAGTTCGGCCACATGCTCGCCGGCATCCTGAAGAAATACGGCGTCGCTGGAGAAGGCATCTCGTTCGATCAGGGCGCCCGCACCGCCTTGGCCTTCGTGACCCTACGCGCCGACGGTGAACGTGAGTTCATGTTCTACCGGAACCCTAGCGCCGATATGCTGCTGAAGCCCGACGAGCTCAACATCGAGCTCATCAAATCCGCCAAAGTGTTCCACTATGGATCCATTAGCTTGATCGTGGAGCCGTGCAGATCGGCACATCTGAAGGCAATGGAGGTGGCTAAAGAAGCAGGTGCATTGCTCTCCTACGACCCGAACCTCCGGGAGCCGCTGTGGCCGTCGCGGGAAGAGGCAAAGAAGCAGATAATGAGCATATGGGATAAGGCCGATGTGATCAAGGTGAGTGATGTGGAGCTGGAGTTCCTTACAGGGAGCCCCAAGATTGATGATGCCAATGCCATGACACTGTGGAGAGATAGCTTGAAGCTCCT...