Method for increasing plant cellulose content by utilizing apple fructokinase gene
A technology of plant cellulose and fructokinase, applied in the field of genetic engineering, can solve the problem of ambiguous cellulose biomass in stems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0040] The invention provides an apple fructokinase gene MdFRK2, the nucleotide sequence of which is shown in SEQ ID NO.1:
[0041] SEQ ID NO.1:
[0042] ATGGCTAACAATGGCGTACCGCAGACCGGAAAGGGTATGATCGTGAGTTTCGGCGAGATGCTGATCGACTTCGTCCCCACCGAATCGGGCGTTTCTCTTGCCGAAGCTCCTGGCTTCCTCAAAGCCCCAGGCGGGGCCCCCGCCAACGTGGCGATCGCCGTGGCTCGCCTCGGCGGAAAGGCCGCGTTCGTCGGAAAACTCGGCGACGACGAGTTCGGCCACATGCTCGCCGGCATCCTGAAGAAATACGGCGTCGCTGGAGAAGGCATCTCGTTCGATCAGGGCGCCCGCACCGCCTTGGCCTTCGTGACCCTACGCGCCGACGGTGAACGTGAGTTCATGTTCTACCGGAACCCTAGCGCCGATATGCTGCTGAAGCCCGACGAGCTCAACATCGAGCTCATCAAATCCGCCAAAGTGTTCCACTATGGATCCATTAGCTTGATCGTGGAGCCGTGCAGATCGGCACATCTGAAGGCAATGGAGGTGGCTAAAGAAGCAGGTGCATTGCTCTCCTACGACCCGAACCTCCGGGAGCCGCTGTGGCCGTCGCGGGAAGAGGCAAAGAAGCAGATAATGAGCATATGGGATAAGGCCGATGTGATCAAGGTGAGTGATGTGGAGCTGGAGTTCCTTACAGGGAGCCCCAAGATTGATGATGCCAATGCCATGACACTGTGGAGAGATAGCTTGAAGCTCCT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap