Method for increasing plant cellulose content by utilizing apple fructokinase gene
A technology of plant cellulose and fructokinase, applied in the field of genetic engineering, can solve the problem of ambiguous cellulose biomass in stems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0040] The invention provides an apple fructokinase gene MdFRK2, the nucleotide sequence of which is shown in SEQ ID NO.1:
[0041] SEQ ID NO.1:
[0042] ATGGCTAACAATGGCGTACCGCAGACCGGAAAGGGTATGATCGTGAGTTTCGGCGAGATGCTGATCGACTTCGTCCCCACCGAATCGGGCGTTTCTCTTGCCGAAGCTCCTGGCTTCCTCAAAGCCCCAGGCGGGGCCCCCGCCAACGTGGCGATCGCCGTGGCTCGCCTCGGCGGAAAGGCCGCGTTCGTCGGAAAACTCGGCGACGACGAGTTCGGCCACATGCTCGCCGGCATCCTGAAGAAATACGGCGTCGCTGGAGAAGGCATCTCGTTCGATCAGGGCGCCCGCACCGCCTTGGCCTTCGTGACCCTACGCGCCGACGGTGAACGTGAGTTCATGTTCTACCGGAACCCTAGCGCCGATATGCTGCTGAAGCCCGACGAGCTCAACATCGAGCTCATCAAATCCGCCAAAGTGTTCCACTATGGATCCATTAGCTTGATCGTGGAGCCGTGCAGATCGGCACATCTGAAGGCAATGGAGGTGGCTAAAGAAGCAGGTGCATTGCTCTCCTACGACCCGAACCTCCGGGAGCCGCTGTGGCCGTCGCGGGAAGAGGCAAAGAAGCAGATAATGAGCATATGGGATAAGGCCGATGTGATCAAGGTGAGTGATGTGGAGCTGGAGTTCCTTACAGGGAGCCCCAAGATTGATGATGCCAATGCCATGACACTGTGGAGAGATAGCTTGAAGCTCCT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



