Method for constructing Cyp17a1 Cre animal model based on CRISPR-Cas9
An animal model, the technology of p2a-cre, applied in the field of biomedicine, can solve the problems of unstable Cre enzyme expression, low construction efficiency, random insertion position, etc., and achieve a reliable preparation method, good stability and specificity, and overcome the insertion position. random effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0043]Further, the specific steps of the sgRNA synthesis method are as follows: a DNA fragment of Cyp17a1-sgRNA is obtained by PCR amplification, the DNA fragment is used as a template for in vitro transcription, and the transcription product is purified to obtain the sgRNA, wherein the upstream of the in vitro transcription The primers from 5'to 3'are: T7RNA polymerase promoter, gRNA sequence and the sequence binding to the gRNA vector template, as follows:
[0044]TAATACGACTCACTATAGGACGTTAGATTCGGCCTCTGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 3);
[0045]or,
[0046]TAATACGACTCACTATAGATGGAAGGATGCACAGGTTGGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 4).
[0047]The second aspect of the present invention provides a kit for constructing Cre enzyme expression animal model based on CRISPR-Cas9 technology. The kit includes Cas9mRNA, gRNA and a homologous vector containing p2A-Cre sequence. The gRNA has a first The gene sequence described in the aspect.
[0048]Preferably, the Cas9 mRNA is obtained by in vitro transcript...
Embodiment 1
[0057]In this embodiment, a technical solution for constructing Cyp17a1 Cre tool mice based on CRISPR-Cas9 technology is provided.
[0058]1. Target gene name (MGI number): Cyp17a1 (MGI:88586)
[0059]Website link of target gene Ensemble:
[0060]http: / / asia.ensembl.org / Mus_musculus / Gene / Summary? db=core; g=ENSMUSG00000003555; r=19:46667165-46673172
[0061]Corresponding transcript (Ensemble number): Cyp17a1-201 (ENSMUST00000026012.7)
[0062]2. Design sgRNA:
[0063]Search for a sequence of 80 bp in the upper and lower reaches of the stop codon TAG of the target gene from -40 to 40 bp to design a suitable sgRNA sequence (figure 2 ). The designed sgRNA sequence is shown in the table below.
[0064]Table 1 Score and sequence of candidate sgRNA
[0065]
[0066]3. Obtain sgRNA and Cas9mRNA by in vitro transcription
[0067](1) Synthesize sgRNA of Cyp17a1 gene by PCR method. Using gRNA-Vector as a template, the DNA fragment of Cyp17a1-sgRNA was first amplified by PCR, and the PCR product was recovered by gel and us...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


