Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for constructing Cyp17a1 Cre animal model based on CRISPR-Cas9

An animal model, the technology of p2a-cre, applied in the field of biomedicine, can solve the problems of unstable Cre enzyme expression, low construction efficiency, random insertion position, etc., and achieve a reliable preparation method, good stability and specificity, and overcome the insertion position. random effect

Active Publication Date: 2021-02-26
SHANDONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been reports of Cyp17a1 Cre mice abroad (Bridges PJ.Genesis.2008), but this mouse was constructed by using the Cyp17a1 promoter sequence and Cre enzyme sequence to construct an expression vector, and then injecting the expression vector into fertilized eggs. There are disadvantages such as random insertion position, low construction efficiency, unstable expression of Cre enzyme, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing Cyp17a1 Cre animal model based on CRISPR-Cas9
  • Method for constructing Cyp17a1 Cre animal model based on CRISPR-Cas9
  • Method for constructing Cyp17a1 Cre animal model based on CRISPR-Cas9

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0043]Further, the specific steps of the sgRNA synthesis method are as follows: a DNA fragment of Cyp17a1-sgRNA is obtained by PCR amplification, the DNA fragment is used as a template for in vitro transcription, and the transcription product is purified to obtain the sgRNA, wherein the upstream of the in vitro transcription The primers from 5'to 3'are: T7RNA polymerase promoter, gRNA sequence and the sequence binding to the gRNA vector template, as follows:

[0044]TAATACGACTCACTATAGGACGTTAGATTCGGCCTCTGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 3);

[0045]or,

[0046]TAATACGACTCACTATAGATGGAAGGATGCACAGGTTGGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 4).

[0047]The second aspect of the present invention provides a kit for constructing Cre enzyme expression animal model based on CRISPR-Cas9 technology. The kit includes Cas9mRNA, gRNA and a homologous vector containing p2A-Cre sequence. The gRNA has a first The gene sequence described in the aspect.

[0048]Preferably, the Cas9 mRNA is obtained by in vitro transcript...

Embodiment 1

[0057]In this embodiment, a technical solution for constructing Cyp17a1 Cre tool mice based on CRISPR-Cas9 technology is provided.

[0058]1. Target gene name (MGI number): Cyp17a1 (MGI:88586)

[0059]Website link of target gene Ensemble:

[0060]http: / / asia.ensembl.org / Mus_musculus / Gene / Summary? db=core; g=ENSMUSG00000003555; r=19:46667165-46673172

[0061]Corresponding transcript (Ensemble number): Cyp17a1-201 (ENSMUST00000026012.7)

[0062]2. Design sgRNA:

[0063]Search for a sequence of 80 bp in the upper and lower reaches of the stop codon TAG of the target gene from -40 to 40 bp to design a suitable sgRNA sequence (figure 2 ). The designed sgRNA sequence is shown in the table below.

[0064]Table 1 Score and sequence of candidate sgRNA

[0065]

[0066]3. Obtain sgRNA and Cas9mRNA by in vitro transcription

[0067](1) Synthesize sgRNA of Cyp17a1 gene by PCR method. Using gRNA-Vector as a template, the DNA fragment of Cyp17a1-sgRNA was first amplified by PCR, and the PCR product was recovered by gel and us...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for constructing a Cyp17a1 Cre animal model based on CRISPRCas9, and aims at overcoming the defects of random insertion position, low construction efficiency, unstableCre enzyme expression and the like in the existing model animal construction method for obtaining a Cre enzyme expression model mouse by modifying a Cyp17a1 gene. According to the method for constructing the Cyp17a1 Cre animal model, a CRISPRCas9 technology is applied, and a Cre enzyme expression sequence is inserted at a fixed point in front of a termination codon TAG of a Cyp17a1 gene accordingto a homologous recombination principle, so that a new Cyp17a1 Cre tool mouse is accurately and efficiently constructed, and stability and specificity of Cre enzyme expression are verified.

Description

Technical field[0001]The invention belongs to the technical field of biomedicine, and specifically relates to a method for constructing a Cyp17a1 Cre animal model based on CRISPR-Cas9.Background technique[0002]Disclosure of the background information is only intended to increase the understanding of the overall background of the present invention, and is not necessarily regarded as an acknowledgement or any form of suggestion that the information constitutes the prior art known to those of ordinary skill in the art.[0003]Ovary is an important reproductive organ of female animals, and its main functions include producing eggs and secreting sex hormones. The sex hormones secreted by the ovaries are mainly estrogen and progesterone, in addition to a certain amount of androgens. They are all steroid hormones and share a common synthesis pathway: pregnenolone derived from cholesterol is converted into androgen (testosterone) in the follicular membrane cells by aromatase. Testosterone is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85A01K67/027
CPCC12N15/1137C12N15/8509A01K67/0275C12N9/90C12Y599/01002C12Y114/99009C12N2800/107A01K2217/072A01K2227/105A01K2267/03
Inventor 赵涵赵世刚刘悦姜永辉赵如凇高飞
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More