A method for constructing cyp17a1 Cre animal model based on CRISPR-Cas9
An animal model, the technology of p2a-cre, applied in the field of biomedicine, can solve the problems of random insertion position, low construction efficiency, unstable Cre enzyme expression, etc., achieve good stability and specificity, good economic benefits, and overcome vector insertion. position random effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0043]Further, the specific steps of the sgRNA synthesis method are as follows: amplify the DNA fragment of Cyp17a1-sgRNA by PCR, use the DNA fragment as a template to perform in vitro transcription, purify the transcription product to obtain the sgRNA, wherein the upstream of the in vitro transcription The primers from 5' to 3' are: T7 RNA polymerase promoter, gRNA sequence and the sequence that binds to the gRNA vector template, as follows:
[0044] TAATACGACTCACTATAGGACGTTAGATTCGGCCTCTGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 3);
[0045] or,
[0046] TAATACGACTCACTATAGATGGAAGGATGCACAGGTTGGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 4).
[0047] In a second aspect, the present invention provides a kit for constructing a Cre enzyme expression animal model based on CRISPR-Cas9 technology. The kit includes Cas9mRNA, gRNA and a homologous vector containing p2A-Cre sequence, and the gRNA has the first The gene sequence described in the aspect.
[0048] Preferably, the Cas9 mRNA is obtained by...
Embodiment 1
[0057] In this example, a technical solution for constructing Cyp17a1 Cre tool mice based on CRISPR-Cas9 technology is provided.
[0058] 1. Target gene name (MGI number): Cyp17a1 (MGI: 88586)
[0059] Target gene Ensemble website link:
[0060] http: / / asia.ensembl.org / Mus_musculus / Gene / Summary? db=core; g=ENSMUSG00000003555; r=19:46667165-46673172
[0061] Corresponding transcript (Ensemble number): Cyp17a1-201 (ENSMUST00000026012.7)
[0062] 2. Design sgRNA:
[0063] Search the sequence of 80 bp upstream and downstream of the target gene stop codon TAG -40 ~ 40 bp to design a suitable sgRNA sequence ( figure 2 ). The designed sgRNA sequences are shown in the table below.
[0064] Table 1 Scores and sequences of candidate sgRNAs
[0065]
[0066] 3. Obtain sgRNA and Cas9mRNA by in vitro transcription
[0067] (1) The sgRNA of Cyp17a1 gene was synthesized by PCR method. Using gRNA-Vector as a template, the DNA fragment of Cyp17a1-sgRNA was first amplified by PCR, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



