Check patentability & draft patents in minutes with Patsnap Eureka AI!

A method for constructing cyp17a1 Cre animal model based on CRISPR-Cas9

An animal model, the technology of p2a-cre, applied in the field of biomedicine, can solve the problems of random insertion position, low construction efficiency, unstable Cre enzyme expression, etc., achieve good stability and specificity, good economic benefits, and overcome vector insertion. position random effect

Active Publication Date: 2022-04-12
SHANDONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been reports of Cyp17a1 Cre mice abroad (Bridges PJ.Genesis.2008), but this mouse was constructed by using the Cyp17a1 promoter sequence and Cre enzyme sequence to construct an expression vector, and then injecting the expression vector into fertilized eggs. There are disadvantages such as random insertion position, low construction efficiency, unstable expression of Cre enzyme, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for constructing cyp17a1 Cre animal model based on CRISPR-Cas9
  • A method for constructing cyp17a1 Cre animal model based on CRISPR-Cas9
  • A method for constructing cyp17a1 Cre animal model based on CRISPR-Cas9

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0043]Further, the specific steps of the sgRNA synthesis method are as follows: amplify the DNA fragment of Cyp17a1-sgRNA by PCR, use the DNA fragment as a template to perform in vitro transcription, purify the transcription product to obtain the sgRNA, wherein the upstream of the in vitro transcription The primers from 5' to 3' are: T7 RNA polymerase promoter, gRNA sequence and the sequence that binds to the gRNA vector template, as follows:

[0044] TAATACGACTCACTATAGGACGTTAGATTCGGCCTCTGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 3);

[0045] or,

[0046] TAATACGACTCACTATAGATGGAAGGATGCACAGGTTGGTTTAAGAGCTATGCTGGAAAC (SEQ ID NO: 4).

[0047] In a second aspect, the present invention provides a kit for constructing a Cre enzyme expression animal model based on CRISPR-Cas9 technology. The kit includes Cas9mRNA, gRNA and a homologous vector containing p2A-Cre sequence, and the gRNA has the first The gene sequence described in the aspect.

[0048] Preferably, the Cas9 mRNA is obtained by...

Embodiment 1

[0057] In this example, a technical solution for constructing Cyp17a1 Cre tool mice based on CRISPR-Cas9 technology is provided.

[0058] 1. Target gene name (MGI number): Cyp17a1 (MGI: 88586)

[0059] Target gene Ensemble website link:

[0060] http: / / asia.ensembl.org / Mus_musculus / Gene / Summary? db=core; g=ENSMUSG00000003555; r=19:46667165-46673172

[0061] Corresponding transcript (Ensemble number): Cyp17a1-201 (ENSMUST00000026012.7)

[0062] 2. Design sgRNA:

[0063] Search the sequence of 80 bp upstream and downstream of the target gene stop codon TAG -40 ~ 40 bp to design a suitable sgRNA sequence ( figure 2 ). The designed sgRNA sequences are shown in the table below.

[0064] Table 1 Scores and sequences of candidate sgRNAs

[0065]

[0066] 3. Obtain sgRNA and Cas9mRNA by in vitro transcription

[0067] (1) The sgRNA of Cyp17a1 gene was synthesized by PCR method. Using gRNA-Vector as a template, the DNA fragment of Cyp17a1-sgRNA was first amplified by PCR, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a method for constructing a Cyp17a1 Cre animal model based on CRISPR-Cas9. The Cyp17a1 gene is transformed to obtain a Cre enzyme expression model mouse. In the existing model animal construction method, there are random insertion positions, low construction efficiency, and Cre enzyme expression. Insufficient expression such as instability. In view of the above-mentioned technical defects, the present invention provides a method for constructing a Cyp17a1 Cre animal model, using CRISPR-Cas9 technology, according to the principle of homologous recombination, inserting the Cre enzyme expression sequence at a fixed point before the stop codon TAG of the Cyp17a1 gene, accurately and efficiently A new Cyp17a1 Cre tool mouse was constructed and the stability and specificity of its Cre enzyme expression were verified.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a method for constructing a Cyp17a1 Cre animal model based on CRISPR-Cas9. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] The ovary is an important reproductive organ in female animals, and its main functions include producing eggs and secreting sex hormones. The sex hormones secreted by the ovary are mainly estrogen and progesterone, in addition to a certain amount of androgen. They all belong to steroid hormones and have a common synthetic pathway: pregnenolone derived from cholesterol is converted into androgen (testosterone) by aromatase in theca cells, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85A01K67/027
CPCC12N15/1137C12N15/8509A01K67/0275C12N9/90C12Y599/01002C12Y114/99009C12N2800/107A01K2217/072A01K2227/105A01K2267/03
Inventor 赵涵赵世刚刘悦姜永辉赵如凇高飞
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More