Detection and application of methylation sites of human FITM1 and HIST1H2BJ genes
A methylation and site technology, applied in the field of biomedicine, can solve problems such as unreported relationship with liver cancer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0040] 1. Specific site analysis
[0041] use Infinium HumanMethylation27 BeadChip Methylation microarray screened the difference between the methylation profiles of primary hepatocellular carcinoma and corresponding paracancerous tissues, and found that in the genomic DNA of primary hepatocellular carcinoma, a site in the promoter region of the FITM1 gene ( The methylation level of this site numbered (cg06186808) in the above methylation chip was significantly higher than that of the para-cancer group, and the methylation level of a site (cg04424621) in the promoter region of the HIST1H2BJ gene was significantly lower than that of the para-cancer group .
[0042] The sequence of the FITM1 gene-specific site is (SEQ ID No.1):
[0043] CCTGCTCAAGGTGCTGCTCTGGGTGGCCTCTGCCTTGCTGTACTTTGGAAGCGAACAGGC[CG]CCCGCCTTCTGGGCAGCCCCTGCTTACGGCGCCTCTACCATGCCTGGCTGGCAGCAGTGG
[0044] The sequence of the HIST1H2BJ gene-specific site is (SEQ ID No.2):
[0045] GTAAGCAACTTGGGATATTAGGCCTTTCCAA...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap