Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SiRNA for silencing GIPC1 gene, recombinant vector and application of siRNA and recombinant vector

A technology for recombining vectors and genes, applied in the field of biomedicine, to achieve the effect of enriching molecular mechanisms

Active Publication Date: 2021-05-28
NANJING NORMAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This application has discovered a new PDZ family member—GIPC1 (GAIP interacting protein, C-terminus 1) that can interact with SR-B1, and there is no related report so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SiRNA for silencing GIPC1 gene, recombinant vector and application of siRNA and recombinant vector
  • SiRNA for silencing GIPC1 gene, recombinant vector and application of siRNA and recombinant vector
  • SiRNA for silencing GIPC1 gene, recombinant vector and application of siRNA and recombinant vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The present application will be described in detail below in conjunction with specific embodiments.

[0034] Construction of the vector for knocking down GIPC1:

[0035] ShGIPC1F5':

[0036] GATCCGCAGTGTGATTGACCACATTCTTCAAGAGAGAATGTGGTCAATCACACTGCTTTTTTGGAAA

[0037] ShGIPC1-R5':

[0038] AGCTTTTCCAAAAAAGCAGTGTGATTGACCACATTCTCTCTTGAAGAATGTGGTCAATCACACTGCG

[0039] Through the website: (https: / / www.sigmaaldrich.com / life-science / functional-genomics-and-rnai / shrna.html) select "Life Science", "Advanced Genomics", "CRISPR Technology&RNAi", "siRNA" , "Predesigned siRNA" option, enter the ID name of GIPC1 in the dialog box to obtain multiple GIPC1 knockdown sequences, select the three sequences with the highest ranking, and synthesize specific DNA sequences, 95-degree annealing and complementation to become enzymes with BamH1 and HandⅢ The DNA duplex at the cohesive end of the cleavage site was connected to the Psilencer3.0-H1 vector digested with BamH1 and HandIII enzyme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel knock-down sequence of a protein of a PDZ family member, namely GIPC1, and an interaction of the knock-down sequence and SR-B1. The application also proves that the GIPC1 is combined with the intracellular structural domain of the SR-B1 through the PDZ structural domain of the protein of the GIPC1 through experiments. According to the present invention, the co-transfection GIPC1 overexpression vector can significantly increase the protein content of SR-B1 in cells, the knock-down sequence is adopted to knock down the GIPC1 so as to reduce the expression of SR-B1 in mouse liver tissues and regulate the lipid metabolism in mouse bodies, and the important effects of the PDZ structural domain and the N-terminal GH1 structural domain of the GIPC1 protein in the expression regulation of the SR-B1 protein are found; according to the application, the molecular mechanism of expression regulation and cholesterol transport regulation of SR-B1 is enriched, and a certain theoretical basis and a potential intervention target are provided for treatment of cardiovascular diseases such as hypercholesteremia and the like.

Description

technical field [0001] This application belongs to biomedical technology, and in particular relates to a siRNA for silencing GIPC1 gene, a recombinant vector and its application. Background technique [0002] High-density lipoprotein-specific class B type I receptor (Scanverger receptor class B type I, SR-B1) plays a key role in cholesterol transport metabolism, which can selectively uptake high-density lipoprotein cholesteryl ester into cells (High density lipoprotein cholesterol ester, HDL-CE), thereby clearing cholesterol in plasma by affecting the "reverse cholesterol transport (Reverse cholesterol transport, RCT)" pathway. The main RCT pathway in which SR-B1 participates is as follows: Under the action of Cholesterolester transfer protein (CETP), high density lipoprotein (High density lipoprotein, HDL) converts excess cholesterol absorbed from peripheral tissues into cholesterol ester (Cholesterol ester, CE), then SR-B1 mediates the selective uptake of CE by the liver ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85A61K31/7088A61P3/06
CPCC12N15/113C12N15/85A61P3/06C12N2310/14C12N2320/32C12N2800/107
Inventor 胡志刚郭志刚周茜张子喻刘蕊
Owner NANJING NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com