SiRNA for silencing GIPC1 gene, recombinant vector and application of siRNA and recombinant vector
A technology for recombining vectors and genes, applied in the field of biomedicine, to achieve the effect of enriching molecular mechanisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] The present application will be described in detail below in conjunction with specific embodiments.
[0034] Construction of the vector for knocking down GIPC1:
[0035] ShGIPC1F5':
[0036] GATCCGCAGTGTGATTGACCACATTCTTCAAGAGAGAATGTGGTCAATCACACTGCTTTTTTGGAAA
[0037] ShGIPC1-R5':
[0038] AGCTTTTCCAAAAAAGCAGTGTGATTGACCACATTCTCTCTTGAAGAATGTGGTCAATCACACTGCG
[0039] Through the website: (https: / / www.sigmaaldrich.com / life-science / functional-genomics-and-rnai / shrna.html) select "Life Science", "Advanced Genomics", "CRISPR Technology&RNAi", "siRNA" , "Predesigned siRNA" option, enter the ID name of GIPC1 in the dialog box to obtain multiple GIPC1 knockdown sequences, select the three sequences with the highest ranking, and synthesize specific DNA sequences, 95-degree annealing and complementation to become enzymes with BamH1 and HandⅢ The DNA duplex at the cohesive end of the cleavage site was connected to the Psilencer3.0-H1 vector digested with BamH1 and HandIII enzyme...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com