Unlock instant, AI-driven research and patent intelligence for your innovation.

Rice sugar-induced promoter SRN1 and application thereof

A promoter and rice technology, applied in the field of genetic engineering, can solve the problem that the nucleic acid sequence has not been discovered

Active Publication Date: 2021-06-18
CHINA NAT RICE RES INST
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the nucleic acid sequence of a highly efficient sucrose-inducible promoter has not been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice sugar-induced promoter SRN1 and application thereof
  • Rice sugar-induced promoter SRN1 and application thereof
  • Rice sugar-induced promoter SRN1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Sequence Analysis of Rice Promoter SRN1

[0031] Using the plant promoter prediction analysis website PlantCARE ( http: / / bioinformatics.psb.ugent.be / webtools / plantcare / ) and New PLACE ( https: / / www.dna.affrc.go.jp / PLACE / ) to analyze and organize the cis-acting elements of the promoter region of the SRN gene 2000bp (ie promoter SRN1), the results are shown in figure 1 and Table 1.

[0032] Table 1 Annotation of sequence information of cis-acting elements in rice promoter SRN1

[0033]

[0034]

[0035] Depend on figure 1 It can be seen from Table 1 that there are 14 cis-acting elements involved in the expression of 8 kinds of responses in the 2000 bp promoter region of the SRN gene (promoter SRN1), and 74% of the cis-acting elements participate in the sugar response and light response processes. Since there is a great correlation between sugar content and light status in plants, the above results indicate that the promoter SRN1 (ie, SRN1 ge...

Embodiment 2

[0036] Example 2: Construction and transformation of rice proSRN1::SRN1-GFP recombinant vector

[0037] (1) Genomic DNA of rice Nip extracted by CTAB method.

[0038] (2) Using rice Nip cDNA as a template for amplifying the coding sequence of the SRN gene, the primer sequences are as follows:

[0039] SRN F: tcaccaaatccctgcaagaaatggtgagcaagggcgaggag; SEQ ID No. 6;

[0040] SRN R: ctgtacatggtagatcttgcgaagatctaccatgtacagctcgt; SEQ ID No. 7.

[0041] (3) According to the 2000 bp sequence upstream of the ATG transcription initiation site of the SRN gene found on the RGAP (http: / / rice.plantbiology.msu.edu / ) website, the promoter SRN1 primer was designed. Use the high-fidelity enzyme KOD FX to amplify the promoter SRN1, and the primer sequences are as follows:

[0042] SRN1pro F 1 : tctctagaactagtggatccatggcgatgacaccgcagct; SEQ ID No.2;

[0043] SRN1pro R 1 : ataagcttgatatcgaattcctagccaccatggtttct; SEQ ID No.3.

[0044] (4) Utilizing the GFP vector as a template for amplifyin...

Embodiment 3

[0048] Example 3: Observation of sugar-induced rice SRN1 gene (promoter SRN1) expression under a fluorescent microscope

[0049] The construction method of pro35s::GFP is as follows:

[0050] (1) According to the 35s promoter sequence found on the NCBI website (http: / / www.ncbi.nlm.nih.gov / nuccore / AF234297 / ), design primers for the 35s promoter. Use the high-fidelity enzyme KOD FX to amplify the promoter 35S, and the primer sequences are as follows:

[0051] 35s pro F: acgaattcgagctcggtacccatggagtcaaagattcaa; SEQ ID No. 10;

[0052] 35s pro R: agtcccccgtgttctctccaaatgaa; SEQ ID No. 11.

[0053] (2) Utilizing the GFP vector as a template for amplifying the coding sequence of the GFP gene. The GFP gene coding sequence was amplified by the high-fidelity enzyme KOD FX, and the primer sequences were as follows:

[0054] GFP F 2 :agtcccccgtgttctctatgacaccgcagcta; SEQ ID No.12;

[0055] GFP R 2 : ctgtacatggtagatcttgcgaagatctaccatgtacagctc; SEQ ID No. 13.

[0056] (3) Finally p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice sugar-induced promoter SRN1 and application thereof. Belongs to the technical field of gene engineering. The nucleotide sequence of the rice sugar-induced promoter SRN1 is as shown in SEQ ID No. 1. The promoter SRN1 belongs to a tissue-specific promoter induced by cane sugar and glucose, and has important application value in the field of plant genetic engineering and research on the conduction mechanism of sugar signal molecules in organisms. The promoter SRN1 provides a tool for directional expression of genes for genetic engineering breeding of important agronomic traits and adversity stress coping of rice or other food crops, and can also be used for indicating the level of soluble sugar in plants in scientific research.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more specifically relates to a rice sugar-induced promoter SRN1 and its application. Background technique [0002] The important agronomic traits of crops and the regulation of gene expression in response to adversity stress are one of the research focuses of plant genetic engineering, and the promoter, as an important regulatory sequence to regulate gene expression, is a research hotspot in plant genetic engineering. Under the stimulation of certain physical or chemical signals, the inducible promoter can greatly increase or inhibit the transcription level of the driver gene. Inducible promoters often have sequence structures such as enhancers and silencers, and some of these promoters exhibit tissue-specific expression or rhythmic expression. [0003] According to different induction conditions, inducible promoters can be divided into light-inducible promoters, temperature-indu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8223C12N15/8238
Inventor 张健李志永童晓红王以锋应杰政
Owner CHINA NAT RICE RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More