Rice sugar-induced promoter SRN1 and application thereof
A promoter and rice technology, applied in the field of genetic engineering, can solve the problem that the nucleic acid sequence has not been discovered
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Sequence Analysis of Rice Promoter SRN1
[0031] Using the plant promoter prediction analysis website PlantCARE ( http: / / bioinformatics.psb.ugent.be / webtools / plantcare / ) and New PLACE ( https: / / www.dna.affrc.go.jp / PLACE / ) to analyze and organize the cis-acting elements of the promoter region of the SRN gene 2000bp (ie promoter SRN1), the results are shown in figure 1 and Table 1.
[0032] Table 1 Annotation of sequence information of cis-acting elements in rice promoter SRN1
[0033]
[0034]
[0035] Depend on figure 1 It can be seen from Table 1 that there are 14 cis-acting elements involved in the expression of 8 kinds of responses in the 2000 bp promoter region of the SRN gene (promoter SRN1), and 74% of the cis-acting elements participate in the sugar response and light response processes. Since there is a great correlation between sugar content and light status in plants, the above results indicate that the promoter SRN1 (ie, SRN1 ge...
Embodiment 2
[0036] Example 2: Construction and transformation of rice proSRN1::SRN1-GFP recombinant vector
[0037] (1) Genomic DNA of rice Nip extracted by CTAB method.
[0038] (2) Using rice Nip cDNA as a template for amplifying the coding sequence of the SRN gene, the primer sequences are as follows:
[0039] SRN F: tcaccaaatccctgcaagaaatggtgagcaagggcgaggag; SEQ ID No. 6;
[0040] SRN R: ctgtacatggtagatcttgcgaagatctaccatgtacagctcgt; SEQ ID No. 7.
[0041] (3) According to the 2000 bp sequence upstream of the ATG transcription initiation site of the SRN gene found on the RGAP (http: / / rice.plantbiology.msu.edu / ) website, the promoter SRN1 primer was designed. Use the high-fidelity enzyme KOD FX to amplify the promoter SRN1, and the primer sequences are as follows:
[0042] SRN1pro F 1 : tctctagaactagtggatccatggcgatgacaccgcagct; SEQ ID No.2;
[0043] SRN1pro R 1 : ataagcttgatatcgaattcctagccaccatggtttct; SEQ ID No.3.
[0044] (4) Utilizing the GFP vector as a template for amplifyin...
Embodiment 3
[0048] Example 3: Observation of sugar-induced rice SRN1 gene (promoter SRN1) expression under a fluorescent microscope
[0049] The construction method of pro35s::GFP is as follows:
[0050] (1) According to the 35s promoter sequence found on the NCBI website (http: / / www.ncbi.nlm.nih.gov / nuccore / AF234297 / ), design primers for the 35s promoter. Use the high-fidelity enzyme KOD FX to amplify the promoter 35S, and the primer sequences are as follows:
[0051] 35s pro F: acgaattcgagctcggtacccatggagtcaaagattcaa; SEQ ID No. 10;
[0052] 35s pro R: agtcccccgtgttctctccaaatgaa; SEQ ID No. 11.
[0053] (2) Utilizing the GFP vector as a template for amplifying the coding sequence of the GFP gene. The GFP gene coding sequence was amplified by the high-fidelity enzyme KOD FX, and the primer sequences were as follows:
[0054] GFP F 2 :agtcccccgtgttctctatgacaccgcagcta; SEQ ID No.12;
[0055] GFP R 2 : ctgtacatggtagatcttgcgaagatctaccatgtacagctc; SEQ ID No. 13.
[0056] (3) Finally p...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



