Method for detecting multiple target nucleic acids, a kit and application thereof
A technology with multiple targets and detection methods, applied in the field of molecular biology, can solve the problems of inability to achieve rapid detection, limited popularization and use, and insurmountable problems, and achieve the effects of being conducive to high-throughput applications, shortening reaction time, and high repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Example 1: The loop-mediated isothermal amplification technique for signal detection based on the scorpion primer probe simultaneously detects HBV, HCV, HIV
[0065] (1) Primer design:
[0066] Loop-mediated isothermal amplification (LAMP) primers were designed for HBV, HCV, HIV. The primer sequences are shown in Table 1:
[0067] Table 1: Primer sequence list for HBV, HCV, HIV
[0068]
[0069]
[0070] The cDNA sequences of HBV, HCV and HIV are as follows:
[0071] HBV target gene base sequence SEQ ID NO:19
[0072] GGGGGAAAGCCCTACGAACCACTGAACAAATGGCACTAGTAAACTGAGCCAGGAGAAACGGACTGAGGCCCACTCCCATAGGAATCTTGCGAAAGCCCAAGATGATGGGATGGGAATACAAGTGCAGTTTCCGTCCGAAGGTTTTGTACAGCAACAAGAGGGAAACATAGAGGTTCCTTGAGCAGGAATCGTGCAGGTCTTGCATGGTCCCGTGCTGGTAGTTGATGTTCCTGGAAGTAGAGGACAAACGGGCAACATACCTTGGTAGTCCAGAAGAACCAACAAGAAGATGAGGCATAGCAGCAGGATGAAGAGGAATATGATAAAACGCCGCAGACACATCCAGCGATAGCCAGGACAAATTGGAGGACAAGAGGTTGGTGAGTGATTGGAGGTTGGGGACTGCGAATTTTGGCCAGGACACGTGGGTGCTCCCCCTAGAAAATT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


