Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP (Single Nucleotide Polymorphism) site for identifying Lonicera japonica and Lonicera confusa and amplification primer

A technology of Shan Yinhua and honeysuckle, applied in the field of molecular biology, can solve problems such as poor reproducibility

Inactive Publication Date: 2021-08-17
CHANGSHA UNIVERSITY
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The main disadvantage of using only DNA barcodes to identify honeysuckle and mountain silver flowers is poor reproducibility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1. Query the sequence of the FNSII gene (GenBank accession numbers are KU127577.1 and KU127581.1) published on GenBank in GenBank, and cut according to the homology and variability of the sequence in NCBI , design homologous cloning primers as follows:

[0023] Forward primer F: ATGTNGATCTTTGACCTCACAATCT;

[0024] Reverse primer R: AGGTAATATA ATGAAGTNTGTACATACC; the designed primers are used to clone the shorter fragments in the alternative splicing sequence of the FNSII gene from each sample DNA.

[0025]2. Use takara high-fidelity enzyme to amplify the specific FNSII gene in Lonicera genus from each sample DNA, and use the TA cloning method to sequence the cloned fragments. The sequence fragments obtained by cloning are transformed into Escherichia coli after ligation with the PMD19-T vector, and the general primers of the PMD19-T vector are used

[0026] M13F: CGCCAGGGTTTTTCCCAGTCACGAC

[0027] M13R: AGCGGATAACAATTTCACAC AGGA

[0028] The selected positive coloni...

Embodiment 2

[0032] The following SNP sites were obtained by the method of Example 1: 40T / C, 97T / C, 107A / G, 141T / C, 219A / G, 235A / C, 252A / C, 327T / C, 364T / G, 543A / G, 597T / C, 616A / G, 630A / G, 711C / T, 797A / G, 807T / C, 846C / T, 849T / C, 864C / T, and found that loci 219A / G and 864C / T can distinguish honeysuckle from mountain silver flower; 97T / C, 327T / C, 364T / G, 543A / G, 616A / G, 630A / G, 807T / C, 849T / C can distinguish Yulei No. 1 gray felt honeysuckle , yellow-brown Lonicera and Lonicera chinensis, Lonicera gracilis, and Lonicera red glandularis; SNP loci 107A / G, 252A / C, 846C / T can distinguish between gray Lonicera spp. C, 141T / C, 597T / C, 711C / T, and 797A / G can distinguish Lonicera chinensis from Lonicera spp. glandular honeysuckle.

Embodiment 3

[0034] This example provides a set of single nucleotide polymorphism sites (SNPs) for identifying honeysuckle and mountain silver, as well as primers and identification methods. Identification method of the present invention is realized through the following technical solutions:

[0035] When the FNSII gene mRNA sequence has a SNPs genotype of 219A or 219G, and a SNPs genotype of 864C or 864T, use upstream primers SEQ ID NO:1-2 and downstream primers SEQ ID NO:19-20 to amplify the FNSII gene mRNA sequence , and compare the target fragments by sequencing analysis. When the genotypes of SNPs of the target fragment are 219A and 864C, it is identified as Lonicera japonica; when the genotypes of SNPs are 219G and 864T, it is identified as Lonicera japonica. Wherein, the upstream primer SEQ ID NO:1 is used to amplify the 219A site, the upstream primer SEQ ID NO:2 is used to amplify the 219G site, the downstream primer SEQ ID NO:19 is used to amplify the 864C site, and the downstrea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a single nucleotide polymorphism (SNP) site for identifying Lonicera japonica and Lonicera confusa. The SNPs comprises 219A / G and 864C / T. The invention also provides SNP (Single Nucleotide Polymorphism) loci capable of identifying Lonicera confusa subspecies, wherein the SNP loci comprise 40T / C, 97T / C, 107A / G, 141T / C, 219A / G, 235A / C, 252A / C, 327T / C, 364T / G, 543A / G, 597T / C, 616A / G, 630A / G, 711C / T, 797A / G, 807T / C, 846C / T, 849T / C and 864C / T. The invention also provides a primer for amplifying the SNP site. According to the method, the Lonicera japonica and Lonicera confusa are identified and analyzed by analyzing the SNPs of the FNSII, and the method can be used for identifying the Lonicera japonica and Lonicera confusa and identifying the Lonicera confusa subspecies.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to a SNP site and an amplification primer for identifying honeysuckle and mountain silver flowers. Background technique [0002] The 2005 edition of the "Chinese Pharmacopoeia" classified honeysuckle and mountain silver flower according to the principle of one thing for one: honeysuckle specifically refers to a kind of "Honeysuckle" whose main production area is Shandong, red gland honeysuckle, South China honeysuckle, gray felt honeysuckle and yellow brown hair honeysuckle All belong to mountain silver flower. In view of the fact that both Lonicerae and Lonicerae are closely related plants of the genus Lonicera, the traits and characteristics of the medicinal materials are relatively similar, resulting in certain difficulties in identification. The current research results show that the fire-reducing effect of honeysuckle stems from its active ingredient - lut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/156C12Q2600/172C12Q2531/113
Inventor 何志敏刘娜余清婷李根朱肖霞杨铭胡珊巍
Owner CHANGSHA UNIVERSITY