Probe for intramolecular amplification of nucleic acid and detection method thereof
A technology for nucleic acid molecules and detection methods, which is applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc., to achieve high specificity, good replication accuracy, and low input costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1. The feasibility of the verification method and the correctness of its principle
[0058] In this example, the probe sequence containing the five regions (5')a-b-a-c-a*(3') described in the content of the invention was designed and synthesized directly by the company, and the nucleic acid intramolecular amplification reaction ( figure 1 ), the feasibility of the method and the correctness of the principle are verified by three methods: fluorescence signal verification method, electrophoresis result verification method and atomic force microscope result verification method. The sequence of the probe synthesized in this example is (AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGT ACTACCTCT, namely SEQ ID NO. 1). At the same time, the control sequence 1 and the control sequence 2 of the probe were also synthesized. Sequence 1 is that the a* nucleotide sequence at the 3' end is replaced by other nucleotide sequences; the control sequence 2 (the ...
Embodiment 2
[0068] Influence of nucleic acid melting reagents on nucleic acid intramolecular amplification reaction system Since nucleic acid melting reagents have the effect of promoting the dynamic dissociation of nucleic acids, making double-stranded nucleotides into single-stranded nucleotides, first, in order to verify the effect of betaine on the present invention Whether there is a promoting effect, in this example, betaine of different concentrations was added to verify, and a probe (sequence: AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGTAC TACCTCT, i.e. SEQID NO.1) was used to carry out intramolecular nucleic acid amplification. Specific steps are as follows:
[0069] 1) To prepare 23uL of reaction solution, except that betaine is not added, other components are the same as the basic reaction solution. Add 400 nmol / L probe to the prepared reaction solution.
[0070] 2) Take 2ul betaine and add it to the reaction solution configured in step 1), and configure ...
Embodiment 3
[0076] In this example, a probe is formed from a probe precursor, and a colorimetric method of nucleic acid intramolecular amplification is used to detect whether the sample to be tested contains a specific DNA target nucleic acid (taking the DNA virus Boca virus as an example).
[0077]This example uses the boca virus probe precursor (sequence: GCCGGCAGACTTTACTTTTTTTTTTTTTTGCCGGCAGACTCCAATATGTCTGCCGGC, namely SEQ ID NO. 4), boca virus sample 1 (sequence: GCCGGCAGACATATTGGATTCCAAGATGGCGTCTGTACAACC, namely SEQ ID NO. 5), boca virus control sequence sample 2 ( AGCTGCAGATGAGTTGGATTGGAAGAACCCGTGTGTTGTACA, ie SEQ ID NO. 6). Blank control sample 3 (with water instead of detecting nucleic acid sequences) was tested for the ability to detect DNA target nucleic acids by colorimetry.
[0078] Specific steps are as follows:
[0079] 1) prepare 23uL of basic reaction solution, add 2.5umol / L calcein green, 1.5mmol / L manganese chloride, and 400nmol / L boca virus probe precursor;
[0080] 2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



