Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma parvum

A ureaplasma, tiny technology, applied in the field of droplet digital PCR absolute quantitative detection of ureaplasma microns, which can solve the problems of large differences in quantitative results

Pending Publication Date: 2022-07-19
赵缜 +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The standard curves constructed by different laboratories are not the same, and the quantitative results of the same sample in different laboratories are often very different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma parvum
  • Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma parvum
  • Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma parvum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] Design and synthesis of primers and probes

[0029] Primers and probes were designed and synthesized by software and purified by HPLC. The 5′ end of the Ureaplasma microprobe is labeled with a reporter group FAM, and the 3′ end is labeled with a quencher group MGB; the 5′ end of the GAPDH probe is labeled with a reporter group VIC, and the 3′ end is labeled with a quencher group MGB.

[0030] The primer probes involved are as follows:

[0031] Up-F: 5'AGCTGTTTATATATGGAACGAACAA3'(1782nt-1806nt);

[0032] Up-R: 5'TATCCAACTCGCTTAATTCAATT3'(1863nt-1885nt);

[0033] Up-P: 5'TATCAATTAGTTTTGGCTTCT 3'(1822nt-1842nt).

[0034] Collection of actual test samples and extraction of Ureaplasma parvum DNA genome

[0035] Insert the sterile swab into the female cervical orifice for 1-2 cm, rotate it for one week, and take it out after staying for about 10 seconds (it should have a mucous membrane), place it in a sterile sampling tube, and seal it for inspection. Samples should be ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Copy numberaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to a method and a kit for absolutely and quantitatively detecting ureaplasma parvum through microdroplet type digital PCR (Polymerase Chain Reaction). A first set of primers and probes (labeled FAM) are designed according to consistent sequences of genes of four subtypes of ureaplasma parvum, and a second set of primers and probes (labeled VIC) are designed according to a human glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) sequence. The kit can be used for simultaneously detecting four subtypes of ureaplasma parvum and has no cross reaction with ureaplasma urealyticum. According to the present invention, the microdroplet type digital PCR technology is adopted to perform absolute quantification on the ureaplasma parvum in the sample, and the method has advantages of high sensitivity, strong specificity, no standard curve, and incomparable accuracy. The method and the kit can be used for auxiliary diagnosis of ureaplasma parvum infection in clinical laboratories and monitoring of treatment effects after antibacterial drugs are used, and have potential application value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to an in vitro nucleic acid diagnosis method, in particular to a method and a kit for the absolute quantitative detection of Ureaplasma microminis by droplet digital PCR. Background technique [0002] Ureaplasma spp. is one of the pathogens causing human urogenital tract infection. According to molecular biological characteristics, it is divided into two biogroups and 14 serotypes, two biogroups include Ureaplasma parvum (Up) and Ureaplasma urealyticum (Uu). Among them, serotypes 1, 3, 6, and 14 with smaller genomes belong to Ureaplasma parvum, accounting for 90% to 92% of U. Ureaplasma urea, only 8% to 10% of Ureaplasma infections. [0003] Studies have shown that Ureaplasma spp. is closely related to non-gonococcal urethritis, cervicitis, and various adverse pregnancy outcomes (miscarriage, premature birth, chorioamnionitis, premature rupture of membranes, etc.). However, the pathoge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/04C12N15/11C12R1/35
CPCC12Q1/689C12Q1/686C12Q2563/159
Inventor 黄艳芳赵缜
Owner 赵缜
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com