Unlock instant, AI-driven research and patent intelligence for your innovation.

Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma urealyticum

A technology of Ureaplasma urealyticum and detection method, applied in the direction of microorganism-based method, biochemical equipment and method, microorganism determination/inspection, etc.

Pending Publication Date: 2022-07-19
赵缜 +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the standard curves established by different laboratories are not the same, so the qPCR method of the same sample in different laboratories will calculate different copy numbers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma urealyticum
  • Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma urealyticum
  • Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma urealyticum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] Design and synthesis of primers and probes

[0029] Primers and probes were designed and synthesized by software and purified by HPLC. The Ureaplasma urealyticum probe is labeled with a reporter group FAM at the 5′ end and a quencher group MGB at the 3′ end; the GAPDH probe is labeled with a reporter group VIC at the 5′ end and a quencher group MGB at the 3′ end. .

[0030] The primer probes involved are as follows:

[0031] Uu-F: 5'ATTATCAAAACGTGCAATGA 3'(nt2187-nt2206);

[0032] Uu-R: 5'ACCAACTAAAAATGCTGCTAAA 3'(nt2250-nt2271);

[0033] Uu-P: 5' ACCATCACCACTTTATT 3' (nt2208-nt2224).

[0034] Melting curve analysis: Prepare 20 μl reaction system: 10 μl SYBR Green Mix, 0.2 μl 10 μM primer Uu-F, 0.2 μl 10 μM primer Uu-R, 2 μl template, 7.6 μl RNase-free H2O, 2 replicate wells. In addition, no template was added as a negative control.

[0035] Collection of actual test samples and extraction of Ureaplasma DNA genome

[0036] Insert the sterile swab 1-2 cm above the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to a method for absolutely and quantitatively detecting Ureaplasma urealyticum (Uu) and a detection kit. A first set of primers and probes (labeled FAM) are designed according to the consistent sequence of 10 subtypes of ParC genes of ureaplasma urealyticum, and a second set of primers and probes (labeled VIC) are designed according to the sequence of a human glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH). The kit can detect 10 subtypes of ureaplasma urealyticum at the same time, has no cross reaction with ureaplasma parvum, and overcomes the defects that qPCR nucleic acid detection is inaccurate in quantification, the detection result has a gray region and the like. The method and the kit provided by the invention have the characteristics of high specificity, high sensitivity, good repeatability and no dependence on absolute quantification of a standard curve. The method and the kit can be used for auxiliary diagnosis of ureaplasma urealyticum infection in clinical laboratories and monitoring of treatment effect after use of antibacterial drugs, and have potential application value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to an in vitro nucleic acid diagnosis method, in particular to a method and a kit for absolute quantitative detection of Ureaplasma urealyticum by microdroplet digital PCR. Background technique [0002] The prior art discloses that Urealyticum spp. is divided into two biological groups and 14 serotypes according to molecular biological characteristics. Among them, serotypes 2, 4, 5, 8-13 with larger genomes belong to Ureaplasma urealyticum (Uu), accounting for 8%-10% of Ureaplasma infections; the remaining serotypes 1, 3, 6, 14 belongs to Ureaplasma parvum (Ureaplasma parvum, Up), accounting for 90% to 92% of Ureaplasma parvum infections. [0003] Studies have shown that Urealyticum spp. may be closely related to non-gonococcal urethritis, vaginitis, cervicitis, and various adverse pregnancy outcomes (miscarriage, premature birth, chorioamnionitis, premature rupture of membranes, etc.) ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/06C12N15/11C12R1/35
CPCC12Q1/689C12Q1/6851C12Q2600/16C12Q2600/166C12Q2563/159C12Q2563/107C12Q2537/143C12Q2545/101
Inventor 黄艳芳赵缜
Owner 赵缜
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More