Microdroplet digital PCR (Polymerase Chain Reaction) detection method and kit for ureaplasma urealyticum
A technology of Ureaplasma urealyticum and detection method, applied in the direction of microorganism-based method, biochemical equipment and method, microorganism determination/inspection, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] Design and synthesis of primers and probes
[0029] Primers and probes were designed and synthesized by software and purified by HPLC. The Ureaplasma urealyticum probe is labeled with a reporter group FAM at the 5′ end and a quencher group MGB at the 3′ end; the GAPDH probe is labeled with a reporter group VIC at the 5′ end and a quencher group MGB at the 3′ end. .
[0030] The primer probes involved are as follows:
[0031] Uu-F: 5'ATTATCAAAACGTGCAATGA 3'(nt2187-nt2206);
[0032] Uu-R: 5'ACCAACTAAAAATGCTGCTAAA 3'(nt2250-nt2271);
[0033] Uu-P: 5' ACCATCACCACTTTATT 3' (nt2208-nt2224).
[0034] Melting curve analysis: Prepare 20 μl reaction system: 10 μl SYBR Green Mix, 0.2 μl 10 μM primer Uu-F, 0.2 μl 10 μM primer Uu-R, 2 μl template, 7.6 μl RNase-free H2O, 2 replicate wells. In addition, no template was added as a negative control.
[0035] Collection of actual test samples and extraction of Ureaplasma DNA genome
[0036] Insert the sterile swab 1-2 cm above the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



