Supercharge Your Innovation With Domain-Expert AI Agents!

Gene vaccine for anti SARS coronal virus and use thereof

A coronavirus and gene vaccine technology, applied in antiviral agents, applications, gene therapy, etc., can solve the problems of poor antigenicity, instability, and increased production costs of vaccines, and achieve the effects of convenient transportation, cheap price, and easy preparation

Inactive Publication Date: 2003-10-22
WUHAN UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the expressed protein often cannot be processed correctly post-translationally, the antigenicity of the vaccine made using this protein is often poor, and it cannot make the body produce a good protective immune response; in addition, the main component of this vaccine is protein. It is very unstable and needs to be kept in "cold chain transportation" during sales and transportation, which greatly increases its production cost and greatly reduces the effectiveness of this vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene vaccine for anti SARS coronal virus and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] The present invention will be further described in detail with reference to the accompanying drawings:

[0027] 1. Construction of a eukaryotic expression vector containing a nucleotide sequence of 2752bp-3162bp of the full-length SARS coronavirus S protein gene fragment. The gene sequence of 2752bp-3162bp of the full-length SARS coronavirus S protein gene fragment is shown in Table 2.

[0028] Synthesize the 2752bp-3162bp gene fragment of the SARS coronavirus S protein full-length gene fragment, and then use the primer pair by PCR method:

[0029] 5’ggggaattcgacatggaatcacttacaacaacatcaactgc 3’

[0030] 5’cccggatcctactaagcttgctcctgggatggcacatacg 3’

[0031]As a primer, the 2752bp-3162bp gene fragment of the synthesized SARS coronavirus S protein full-length gene fragment was used as a template, and the full-length SARS coronavirus S protein gene with EcoRI and BamHI restriction sites added at both ends was amplified. Fragment of 2752bp-3162bp gene fragment. The total volume...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a gene vaccine for resisting SARS coronavirus and its application, including eucaryotic expressino plasmid containing total or partial gene fragment of total-length gene sequence of SARS coronavirus S protein. The nucleotide sequence of coded SARS coronavirus S protein can be operatively connected with a promotor, then it can express the complete or partial polypeptide of the coded SARS coronavirus S protein in vivo. The described gene vaccine can be used for immunizing host including human body and rodent, for example mouse to make it produce specific protective body fluid immune and cell immune to resist the infection of SARS coronavirus. Said invention is good in stability, convenient in production and low in cost.

Description

Technical field [0001] The present invention relates to the field of vaccines for the prevention and treatment of atypical pneumonia caused by SARS coronavirus, in particular to vaccines encoding the nucleic acid sequence of the SARS coronavirus S protein. It also relates to the use of the vaccine in anti-SARS coronavirus. Background technique [0002] Severe Acute Respiratory Sydrome (SARS) called atypical pneumonia has occurred in more than 20 countries and regions around the world. According to statistics from the World Health Organization, as of 17:00 Geneva time on May 22, the source has reported a total of 8,046 cases and 682 deaths worldwide; a total of 5,285 SARS cases and 303 deaths have been reported in the mainland. This sudden disaster has brought huge personal and economic losses to people all over the world, especially the Chinese people. [0003] As of May 22, there are only chemical drugs that can improve symptoms, such as "sivelestat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/215A61K48/00A61P11/00A61P31/14C12N15/50
Inventor 叶凯丁虹
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More