Gene vaccine for anti SARS coronal virus and use thereof
A coronavirus and gene vaccine technology, applied in antiviral agents, applications, gene therapy, etc., can solve the problems of poor antigenicity, instability, and increased production costs of vaccines, and achieve the effects of convenient transportation, cheap price, and easy preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] The present invention will be further described in detail with reference to the accompanying drawings:
[0027] 1. Construction of a eukaryotic expression vector containing a nucleotide sequence of 2752bp-3162bp of the full-length SARS coronavirus S protein gene fragment. The gene sequence of 2752bp-3162bp of the full-length SARS coronavirus S protein gene fragment is shown in Table 2.
[0028] Synthesize the 2752bp-3162bp gene fragment of the SARS coronavirus S protein full-length gene fragment, and then use the primer pair by PCR method:
[0029] 5’ggggaattcgacatggaatcacttacaacaacatcaactgc 3’
[0030] 5’cccggatcctactaagcttgctcctgggatggcacatacg 3’
[0031]As a primer, the 2752bp-3162bp gene fragment of the synthesized SARS coronavirus S protein full-length gene fragment was used as a template, and the full-length SARS coronavirus S protein gene with EcoRI and BamHI restriction sites added at both ends was amplified. Fragment of 2752bp-3162bp gene fragment. The total volume...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com