Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Secretion expressing type myocardium gene treating plasmid vector

A gene therapy, plasmid vector technology, applied in gene therapy, genetic engineering, plant gene improvement and other directions, can solve the problems of reducing the specificity and effectiveness of gene therapy, and unable to control the specific expression of target genes, and achieve the effect of easy detection.

Inactive Publication Date: 2004-08-25
GUANGDONG GENERAL HOSPITAL
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the general eukaryotic expression plasmid has no cardiomyocyte-specific promoter, it cannot control the specific expression of the target gene in cardiomyocytes, thus greatly reducing the specificity and effectiveness of gene therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Secretion expressing type myocardium gene treating plasmid vector
  • Secretion expressing type myocardium gene treating plasmid vector
  • Secretion expressing type myocardium gene treating plasmid vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Construction of PSec-MLC-Tag2A plasmid

[0061] According to the known human MLC-2V promoter sequence, design synthetic PCR primers: upstream primer, 5'-AATGGGAGTTTGTTTTGGACCCAGAGCACAGAG-3', -downstream primer, 5'-TAATA GCTAGC GGCCGGCCCCTGCTGT-3'(Nhe I), using human genomic DNA as a template, was amplified to obtain the MLC-2V fragment (250 bp). The sequence SEQ ID NO: 4 is as follows:

[0062] GACCCAGAGCACAGAGCATCGTTCCCAGGCCAGGCCCCAGCCACTGTCTCTTTAACCTTGAAGGCATTTTTGGGTCTCAC

[0063] GTGTCCACCCAGGCGGGTGTCGGACTTTGAACGGCTCTTACTTCAGAAGAACGGCATGGGGTGGGGGGGCTTAGGTGGCC

[0064]TCTGCCTCACCTACAACTGCCAAAAGCGGTCATGGGGTTATTTTTTAACCCCAGGGAAGAGGTATTTATTGTTCCACAGCA

[0065] GGGGCCGGCC

[0066] According to the CMV enhancer sequence (CMV enhancer) of the pSec-Tag2A vector, design and synthesize PCR primers: upstream primer, 5′-GCCAGATAT ACGCGT T-3'(Mlu I), downstream primer, 5'-CTCTGTGCTCTGGGTCCAAAACAAACTCCCATT-3', using pSec-Tag2A vector as template, amplified to obta...

Embodiment 2

[0078] Example 2 Construction of pSec-MLC-Tag2B plasmid.

[0079] The pSec-Tag2A plasmid in Example 1 was changed to the pSec-Tag2B plasmid, and the rest were the same as in Example 1.

Embodiment 3

[0080] Example 3 Construction of pSec-MLC-Tag2C plasmid.

[0081] Change Example 1 pSec-mlc-Tag2A plasmid into pSec-Tag2C plasmid, and the rest are the same

[0082] Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a secretory expression type heart gene therapy plasmid vector, it is characterized by that on the secretory type eucaryotic expression vector there are CMV enhanser MLC promotor. Said invented vector can specifically express in cardiac muscle cell, and can secrete the expression product of target gene to the exterior of cell membrane so as to make it exert biological function better.

Description

technical field [0001] The present invention relates to a gene therapy plasmid and its construction method, in particular, the present invention relates to a secretion expression myocardial gene therapy plasmid vector and its construction method. Background technique [0002] Cardiac gene therapy is a novel approach to the treatment of hereditary and congenital heart diseases. The exogenous gene is transferred into cardiomyocytes, through gene expression, so as to achieve the purpose of correcting or enhancing the function of cardiomyocytes. [0003] According to the different carriers used in gene therapy, gene transfer methods can be divided into four categories: viral vector method, non-viral biological carrier method, non-biological carrier method and non-vector method. Plasmid DNA injection is a non-carrier method. Direct intramuscular injection of plasmid DNA is simple and easy, and the injected DNA often cannot be integrated into the chromosome but is free from the c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K9/00A61K48/00A61P9/00C12N15/12C12N15/79C12N15/85
Inventor 余细勇单志新
Owner GUANGDONG GENERAL HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com