Secretion expressing type myocardium gene treating plasmid vector
A gene therapy, plasmid vector technology, applied in gene therapy, genetic engineering, plant gene improvement and other directions, can solve the problems of reducing the specificity and effectiveness of gene therapy, and unable to control the specific expression of target genes, and achieve the effect of easy detection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1 Construction of PSec-MLC-Tag2A plasmid
[0061] According to the known human MLC-2V promoter sequence, design synthetic PCR primers: upstream primer, 5'-AATGGGAGTTTGTTTTGGACCCAGAGCACAGAG-3', -downstream primer, 5'-TAATA GCTAGC GGCCGGCCCCTGCTGT-3'(Nhe I), using human genomic DNA as a template, was amplified to obtain the MLC-2V fragment (250 bp). The sequence SEQ ID NO: 4 is as follows:
[0062] GACCCAGAGCACAGAGCATCGTTCCCAGGCCAGGCCCCAGCCACTGTCTCTTTAACCTTGAAGGCATTTTTGGGTCTCAC
[0063] GTGTCCACCCAGGCGGGTGTCGGACTTTGAACGGCTCTTACTTCAGAAGAACGGCATGGGGTGGGGGGGCTTAGGTGGCC
[0064]TCTGCCTCACCTACAACTGCCAAAAGCGGTCATGGGGTTATTTTTTAACCCCAGGGAAGAGGTATTTATTGTTCCACAGCA
[0065] GGGGCCGGCC
[0066] According to the CMV enhancer sequence (CMV enhancer) of the pSec-Tag2A vector, design and synthesize PCR primers: upstream primer, 5′-GCCAGATAT ACGCGT T-3'(Mlu I), downstream primer, 5'-CTCTGTGCTCTGGGTCCAAAACAAACTCCCATT-3', using pSec-Tag2A vector as template, amplified to obta...
Embodiment 2
[0078] Example 2 Construction of pSec-MLC-Tag2B plasmid.
[0079] The pSec-Tag2A plasmid in Example 1 was changed to the pSec-Tag2B plasmid, and the rest were the same as in Example 1.
Embodiment 3
[0080] Example 3 Construction of pSec-MLC-Tag2C plasmid.
[0081] Change Example 1 pSec-mlc-Tag2A plasmid into pSec-Tag2C plasmid, and the rest are the same
[0082] Example 1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 