Recombinant bacillus Calmette-Guerin vaccine and its preparation method
A technology of BCG and recombinant vaccines, which is applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, bacterial antigen components, etc., to achieve excellent results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The construction of embodiment 1 recombinant PAEI
[0034] (1) Preparation of genomic DNA of Mycobacterium tuberculosis H37Rv strain
[0035] Mycobacterium tuberculosis (H37Rv) was cultured statically for 2 weeks in 7H9Broth liquid medium at 37°C. 80°C for 2 hours to inactivate. Genomic DNA was extracted with a bacterial DNA (miniature) extraction kit. Among them, due to the wall thickness of Mycobacterium tuberculosis, the digestion time of bacteria is extended to 3-5 hours.
[0036] (2) Amplification of the IFN-γ gene of Mycobacterium tuberculosis H37Rv strain ag85b, esat-6 and mice
[0037] Design primers based on ag85b, esat-6 and mouse IFN-γ genes and vector multiple cloning sites:
[0038]Ag85B: 5' end primer P1: ATATGGCCAATGACAGACGTGAGCC
[0039] 3' end primer P2: TATGAATTCGCCGGCGCCTAACG
[0040] Esat-6 5' end primer P1: TATTGGCCAGAATTCATGACAGAGCAGCAGTGG
[0041] 3' end primer P2: TTAGTCGACTGCGAACATCCCAGTG
[0042] mouse IFN-γ gene
[0043]...
Embodiment 2
[0057] Example 2 Identification of recombinant BCG (rBCG::AEI) gene level
[0058] Take 200ml of the above-mentioned cultured bacteria and centrifuge to collect the bacteria, add 20μl of water to boil for 30min, centrifuge and take the supernatant as a template for PCR.
[0059] The results show that the bands obtained by PCR amplification are consistent with the IFN-γ gene (467bp) band size of esat-6 (306bp) and mice (such as figure 2 ). Because BCG itself contains the ag85b gene, even if the ag85b band is amplified by PCR, it cannot be determined whether it contains the exogenous ag85b gene.
Embodiment 3
[0060] Example 3 Identification of recombinant BCG (rBCG::AEI) protein level
[0061] The bacteria of recombinant BCG (rBCG::AEI) were inoculated into 100 ml of modified Roche's medium, and cultured statically at 37° C. for 4-6 weeks. Centrifuge at 8000g at 4°C for 30min to collect the supernatant. It was then freeze-dried, dialyzed, and freeze-dried again.
[0062] The results of Western-blot showed that the obtained band was about 60KD, which was consistent with the predicted size. (Such as image 3 ).
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com