Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant bacillus Calmette-Guerin vaccine and its preparation method

A technology of BCG and recombinant vaccines, which is applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, bacterial antigen components, etc., to achieve excellent results

Inactive Publication Date: 2006-02-22
FUDAN UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant report on the clone of Mycobacterium tuberculosis ag85b, esat-6 and mouse (human) IFN-γ gene into BCG

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus Calmette-Guerin vaccine and its preparation method
  • Recombinant bacillus Calmette-Guerin vaccine and its preparation method
  • Recombinant bacillus Calmette-Guerin vaccine and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The construction of embodiment 1 recombinant PAEI

[0034] (1) Preparation of genomic DNA of Mycobacterium tuberculosis H37Rv strain

[0035] Mycobacterium tuberculosis (H37Rv) was cultured statically for 2 weeks in 7H9Broth liquid medium at 37°C. 80°C for 2 hours to inactivate. Genomic DNA was extracted with a bacterial DNA (miniature) extraction kit. Among them, due to the wall thickness of Mycobacterium tuberculosis, the digestion time of bacteria is extended to 3-5 hours.

[0036] (2) Amplification of the IFN-γ gene of Mycobacterium tuberculosis H37Rv strain ag85b, esat-6 and mice

[0037] Design primers based on ag85b, esat-6 and mouse IFN-γ genes and vector multiple cloning sites:

[0038]Ag85B: 5' end primer P1: ATATGGCCAATGACAGACGTGAGCC

[0039] 3' end primer P2: TATGAATTCGCCGGCGCCTAACG

[0040] Esat-6 5' end primer P1: TATTGGCCAGAATTCATGACAGAGCAGCAGTGG

[0041] 3' end primer P2: TTAGTCGACTGCGAACATCCCAGTG

[0042] mouse IFN-γ gene

[0043]...

Embodiment 2

[0057] Example 2 Identification of recombinant BCG (rBCG::AEI) gene level

[0058] Take 200ml of the above-mentioned cultured bacteria and centrifuge to collect the bacteria, add 20μl of water to boil for 30min, centrifuge and take the supernatant as a template for PCR.

[0059] The results show that the bands obtained by PCR amplification are consistent with the IFN-γ gene (467bp) band size of esat-6 (306bp) and mice (such as figure 2 ). Because BCG itself contains the ag85b gene, even if the ag85b band is amplified by PCR, it cannot be determined whether it contains the exogenous ag85b gene.

Embodiment 3

[0060] Example 3 Identification of recombinant BCG (rBCG::AEI) protein level

[0061] The bacteria of recombinant BCG (rBCG::AEI) were inoculated into 100 ml of modified Roche's medium, and cultured statically at 37° C. for 4-6 weeks. Centrifuge at 8000g at 4°C for 30min to collect the supernatant. It was then freeze-dried, dialyzed, and freeze-dried again.

[0062] The results of Western-blot showed that the obtained band was about 60KD, which was consistent with the predicted size. (Such as image 3 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant bacillus Calmette-Guerin vaccine and its preparation method, wherein tuberculosis mycobacterium ag85b, esat-6 and IFN-gamma gene sequences are inserted into colibacillus-tuberculosis mycobacterium shuttle plasmids to form recombinant plasmid, and are transformed into BCG to form recombinant tuberculosis vaccine. The recombinant vaccine can be used for prevention and treatment of tuberculosis with better immunological effects than BCG.

Description

technical field [0001] The invention belongs to the field of genetic engineering vaccines. Specifically, the invention provides a novel recombinant vaccine of Mycobacterium tuberculosis, that is, the genes of Mycobacterium tuberculosis ag85b, esat-6 and mouse / human IFN-γ are cloned into BCG. Background technique [0002] Tuberculosis still poses a huge threat to mankind. Nearly 32% of the world's population has been infected with Mycobacterium tuberculosis. About 2.7 million people die from tuberculosis every year, an average of more than 7,000 people die every day. The World Health Organization declared tuberculosis a global health emergency in 1993. [0003] my country is one of the 22 countries with a high burden of tuberculosis in the world, and the number of tuberculosis patients ranks second in the world. In 2000, according to the analysis of the results of the fourth national tuberculosis epidemiological sampling survey in my country, the number of infected people ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/74A61K39/04
Inventor 王洪海徐颖王宝林祝秉东王庆忠郄亚卿王九龄
Owner FUDAN UNIV