Lrp4/Corin Dopaminergic Neuron Progenitor Cell Markers

a dopaminergic neuron and progenitor cell technology, applied in the field of polynucleotide probes and antibodies for detecting and selecting can solve the problems of unsatisfactory effect, risk of infection and contamination, method currently being criticized, etc., and achieves long-term therapeutic effects, high degree of safety, and the effect of extremely effective isolating dopaminergic neuron progenitor cells

Inactive Publication Date: 2008-08-21
EISIA R&D MANAGEMENT CO LTD
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0021]There have been no previous reports of genes encoding membrane proteins specifically expressed in dopaminergic neuron proliferative progenitor cells. Antibodies to Lrp4 protein expressed on the cell membrane surface are believed to be extremely effective in isolating dopaminergic neuron progenitor cells. For example, pure dopaminergic neuron progenitor cells can be obtained by isolating Lrp4-expressing cells from the ventral midbrain region or cultured cells containing dopaminergic neuron progenitor cells differentiated in vitro, using anti-Lrp4 antibodies (FIG. 15). Lrp4 expression was confirmed on both of the dopaminergic neuron progenitor cells induced by two different differentiation methods (SDIA method and 5-stage method). Accordingly, Lrp4 is useful as a dopaminergic neuron progenitor cell marker, regardless of cell source. In addition, since ERas and Nanog, which are specifically expressed in ES cells, are not expressed in Lrp4-positive cells, it is possible to select undifferentiated ES cells using Lrp4 expression as an index.
[0022]Moreover, in the present invention, the isolated dopaminergic neuron progenitor cells can also be transplanted directly, or after having been grown in vitro. The dopaminergic neuron progenitor cells of the present invention also have the potential to differentiate and mature at the optimum region in the brain, as well as the potential to additionally grow in vivo, and can be expected to demonstrate long-term therapeutic effects. In addition, if Lrp4-expressing cells are transplanted after having differentiated and matured in vitro, they can be expected to demonstrate therapeutic effects, even if for some reason they do not differentiate into dopaminergic neurons in vivo. In consideration of the risks of tumorigenesis and such, an even higher degree of safety can be expected if cells that have been isolated using a postmitotic dopaminergic neuron precursor cell marker such as 65B13 (WO 2004 / 038018 pamphlet) after differentiating Lrp4-expressing cells grown in vitro are transplanted. The use of Lrp4-expressing cells for transplantation therapy after being isolated, regardless of the method, enables a high degree of safety since only the cell type of interest is isolated. In addition, since the earliest dopaminergic neuron progenitor cells can be used, high therapeutic efficacy can be expected in terms of survival rate, network formation ability, and such. Further, even if the best therapeutic effects cannot be achieved by these early progenitor cells immediately after isolation, since progenitor cells isolated using markers of the present invention can mature in vitro by culturing or such, materials in the optimum stage of differentiation can be prepared (FIG. 6).
[0023]On the other hand, pure dopaminergic neuron progenitor cells are also useful in the search for therapeutic targets for Parkinson's disease, such as for use in the isolation of genes specific to dopaminergic neurons. In particular, dopaminergic neuron proliferative progenitor cells are useful for research on the maturation process of dopaminergic neurons, screening systems using maturation as an index, drug screening in which progenitor cells are grown in vitro or in vivo, screening for drugs that induce differentiation of progenitor cells in vivo (in vivo regenerative therapy drugs), and the like.

Problems solved by technology

As a primary therapeutic method for Parkinson's disease, oral administration of L-DOPA (3,4-dihydroxyphenylalanine) is performed to compensate for the decrease in the amount of dopamine produced; however, the duration of the effect is known to be unsatisfactory.
However, in addition to cell supply and ethical issues (Rosenstain (1995) Exp. Neurol. 33: 106; Turner et al.
33: 1031-7), this method is currently under criticism for various other problems, including risk of infection and contamination, immunological rejection of transplants (Lopez-Lozano et al.
In these methods, a complex procedure that involves altering cell surface antigens (MHC class I antigens) is required to suppress rejection.
In the transplanting of neuron progenitor cells, in addition to the aforementioned problem regarding supply, there is also the possibility that the progenitor cells will differentiate into groups of heterogeneous cells.
However, none of these contain only dopaminergic neurons or cells that differentiate into dopaminergic cells.
This method requires the complicated step of introducing an exogenous gene, and further, the presence of a reporter gene poses problems of toxicity and immunogenicity when used in conjunction with gene therapy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lrp4/Corin Dopaminergic Neuron Progenitor Cell Markers
  • Lrp4/Corin Dopaminergic Neuron Progenitor Cell Markers
  • Lrp4/Corin Dopaminergic Neuron Progenitor Cell Markers

Examples

Experimental program
Comparison scheme
Effect test

example 1

Isolation and Sequence Analysis of a Gene Specific to Dopaminergic Neuron Progenitor Cells

[0133]To isolate genes specific to dopaminergic neuron progenitor cells, the midbrain ventral region of E12.5 mice was additionally cut into two regions in the dorsoventral direction, and genes specifically expressed in the most ventral region containing dopaminergic neurons were identified by the subtraction (N-RDA) method. One of the isolated cDNA fragments was a fragment encoding Lrp4 / Corin. Lrp4 encodes type II transmembrane proteins (FIG. 1).

(1) N-RDA Method

(1)-1. Adapter Preparation

[0134]The following oligonucleotides were annealed to each other, and prepared at 100 μM.

(ad2: ad2S + ad2A, ad3: ad3S + ad3A, ad4:ad4S + ad4A, ad5: ad5S + ad5A, ad13: ad13S +ad13A)ad2S:cagctccacaacctacatcattccgt(SEQ ID NO: 5)ad2A:acggaatgatgt(SEQ ID NO: 6)ad3S:gtccatcttctctctgagactctggt(SEQ ID NO: 7)ad3A:accagagtctca(SEQ ID NO: 8)ad4S:ctgatgggtgtcttctgtgagtgtgt(SEQ ID NO: 9)ad4A:acacactcacag(SEQ ID NO: 10)ad5S:...

example 2

Expression Analysis of the Lrp4 Gene

[0151]Next, an expression analysis of the Lrp4 gene by in situ hybridization was carried out according to the following protocol.

[0152]First, E12.5 mouse embryos were embedded in O.C.T., and fresh frozen sections of 16 μm thickness were prepared. After drying on a slide glass, the sections were fixed in 4% PFA at room temperature for 30 minutes. After washing with PBS, hybridization was carried out at 65° C. for 40 hours (1 μg / ml DIG-labeled RNA probe, 50% formamide, 5×SSC, 1% SDS, 50 μg / ml yeast RNA, 50 μg / ml Heparin). Subsequently, the sections were washed at 65° C. (50% formamide, 5×SSC, 1% SDS) and then treated with RNase (5 μg / ml RNase) at room temperature for 5 minutes. After washing with 0.2×SSC at 65° C. and washing with 1×TBST at room temperature, blocking was carried out (Blocking reagent: Roche). The sections were then reacted with alkaline phosphatase-labeled anti-DIG antibody (DAKO), washed (1×TBST, 2 mM Levamisole), and color develop...

example 3

Expression of Lrp4 in Dopaminergic Neurons Induced to Differentiate from ES Cells

[0155]Next, whether Lrp4 is expressed in ES cells that have been induced to differentiate into dopaminergic neurons in vitro, was examined.

[0156]First, dopaminergic neurons were induced to differentiate from ES cells using the SDIA method (Kawasaki et al. (2000) Neuron 28(1): 3140) (see the upper part of FIG. 7). Cells were recovered 4, 6, 8, 10, and 12 days after induction, and total RNA was recovered using the RNeasy Mini Kit (Qiagen) followed by RT-PCR. In RT-PCR, cDNA was initially synthesized for 1 μg of total RNA using the RNA PCR Kit (TaKaRa). PCR was then carried out in the following reaction system, using as a template cDNA equivalent to 10 ng, 1 ng, and 0.1 ng.

10x ExTaq2μl2.5 mM dNTP1.6μlExTaq0.1μl100 μM primer0.2μl eachcDNA1μlDistilled water14.9μl

[0157]After incubating for 2 minutes at 94° C., 35 PCR cycles of 30 seconds at 94° C., 30 seconds at 65° C., and 2 minutes at 72° C. were carried ou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

The present invention relates to polynucleotide probes and antibodies for detecting Lrp4 / Corin dopaminergic neuron progenitor cell markers, which enable the efficient separation of dopaminergic neuron progenitor cells; and methods for selecting the progenitor cells by the use thereof.

Description

TECHNICAL FIELD[0001]The present invention relates to polynucleotide probes and antibodies for detecting and selecting dopaminergic neuron progenitor cells, and methods for detecting and selecting dopaminergic neuron progenitor cells by using them, and kits and therapeutic methods for treating neurodegenerative diseases such as Parkinson's disease using dopaminergic neuron progenitor cells.BACKGROUND ART[0002]The dopamine system is an extremely important system for essential motor regulation, hormone secretion regulation, emotion regulation, and such in the mammalian brain. Thus, abnormalities in dopaminergic neural transmission cause various neural disorders. For example, Parkinson's disease is a neurodegenerative disease of the extrapyramidal system that occurs due to specific degeneration of dopaminergic neurons in the substantia nigra of the midbrain (Harrison's Principles of Internal Medicine, Vol. 2, 23rd edition, Isselbacher et al., ed., McGraw-Hill Inc., NY (1994), pp. 2275-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K35/12C07H21/04C12N5/06C12Q1/68A61P25/16C07K17/02C12Q1/02C07K16/18A61K31/137A61K35/30A61L27/00A61L27/38A61P25/28A61P43/00C07K16/28C12N5/07C12N5/074C12N5/0793C12N5/0797C12N5/10C12N15/09C12Q1/6881C12Q1/6883
CPCC07K16/286C12Q1/6881C12Q1/6883G01N33/56966C12Q2600/158G01N2500/00G01N2800/2835A61K35/30G01N33/6896A61P25/16A61P25/28A61P43/00C12N15/09C12N5/0623G01N33/5023
InventorSAKAMOTO, YOSHIMASAONO, YUICHIIMAI, TOSHIONAKAGAWA, YASUKO
OwnerEISIA R&D MANAGEMENT CO LTD