Modulation of nuclear-retained RNA
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Antisense Inhibition of Human MALAT1 in A549 Cells
[0321]Antisense oligonucleotides targeted to a metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) nucleic acid, a non-coding nuclear-retained RNA transcript, were tested for their effect on MALAT1 RNA transcript in vitro. Cultured A549 cells at a density of 5,000 cells per well were transfected using Lipofectin reagent with 60 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and MALAT1 RNA transcript levels were measured by quantitative real-time PCR. The human primer probe set RTS2736 (forward sequence AAAGCAAGGTCTCCCCACAAG, designated herein as SEQ ID NO: 89; reverse sequence TGAAGGGTCTGTGCTAGATCAAAA, designated herein as SEQ ID NO: 90; probe sequence TGCCACATCGCCACCCCGTX, designated herein as SEQ ID NO: 91) was used to quantitated MALAT1 RNA. MALAT1 RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent ...
example 2
Antisense Inhibition of Human MALAT1 in A549 Cells
[0323]Antisense oligonucleotides targeted to a MALAT1 nucleic acid were tested for their effects on MALAT1 RNA in vitro. Cultured A549 cells at a density of 5,000 cells per well were transfected using Lipofectin reagent with 150 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and MALAT1 RNA transcript levels were measured by quantitative real-time PCR. Human primer probe set RTS2736 was used to quantitate MALAT1 RNA. MALAT1 RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of MALAT1, relative to untreated control cells.
[0324]The antisense oligonucleotides in Table 4 are 5-10-5 gapmers, where the gap segment comprises ten 2′-deoxynucleosides and each wing segment comprises five 2′-MOE nucleosides. Each nucleotide in the 5′ wing segment and each nucleotide in the 3′ wing segment has a 2′-MOE modification....
example 3
Dose-Dependent Antisense Inhibition of Human MALAT1 in A549 Cells
[0325]Several of the antisense oligonucleotides exhibiting in vitro inhibition of MALAT1 in A549 cells (see Example 2) were tested at various doses. Cells were plated at a density of 5,000 cells per well and transfected using Lipofectin reagent with 7.5 nM, 15 nM, 30 nM, and 60 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and MALAT1 RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS2736 MALAT1 RNA transcript levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 5 as percent inhibition of MALAT1, relative to untreated control cells.
TABLE 5Dose-dependent antisense inhibition of human MALAT1 in A549 cellstested with primer probe set RTS2736ISISIC50No.7.5 nM15 nM30 nM60 nM(nM)395240678190961.83952433154809313.1395244767386910.5395248437087938.1395251577384904.03952...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Fraction | aaaaa | aaaaa |
| Fraction | aaaaa | aaaaa |
| Volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More