Long-acting polypeptides and methods of producing and administering same

a polypeptide and long-acting technology, applied in the field of long-acting polypeptides and methods of producing and administering same, can solve the problems of preventing the affecting the clinical development of many otherwise promising drug candidates, and affecting the clinical development of many

Inactive Publication Date: 2015-06-11
OPKO BIOLOGICS
View PDF4 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Polypeptides are susceptible to denaturation or enzymatic degradation in the blood, liver or kidney.
Moreover, since peptide drugs are usually administered by infusion, frequent injection of peptide drugs causes considerable discomfort to a subject.
Unfavorable pharmacokinetics, such as a short serum half-life, can prevent the pharmaceutical development of many otherwise promising drug candidates.
For example, with lower molecular weight polypeptide drugs, physiological clearance mechanisms such as renal filtration can make the maintenance of therapeutic levels of a drug unfeasible because of cost or frequency of the required dosing regimen.
Conversely, a long serum half-life is undesirable where a drug or its metabolites have toxic side effects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long-acting polypeptides and methods of producing and administering same
  • Long-acting polypeptides and methods of producing and administering same
  • Long-acting polypeptides and methods of producing and administering same

Examples

Experimental program
Comparison scheme
Effect test

example 1

Generation of hGH Constructs

Materials and Methods

[0294]Four hGH clones (variants of 20 kD protein) were synthesized. XbaI-Not I fragments containing hGH sequences from the four variants were ligated into the eukaryotic expression vector pCI-dhfr previously digested with XbaI-NotI. DNA from the 4 clones (401-0, 1, 2, 3 and 4) was prepared. Another partial hGH clone (1-242 bp) from 22 kD protein was also synthesized (0606114). Primers were ordered from Sigma-Genosys. The primer sequences used to generate the hGH-CTP polypeptides of the present invention are summarized in Table 1 hereinbelow.

TABLE 1RestrictionsiteSEQ(underlinedPrimerIDinnumberNOsequencesequence)25275′ CTCTAGAGGACATGGCCAC 3′XbaI32 R285′ ACAGGGAGGTCTGGGGGTTCTGCA 3′33295′ TGCAGAACCCCCAGACCTCCCTGTGC 3′ 4 R305′ CCAAACTCATCAATGTATCTTA 3′25315′ CTCTAGAGGACATGGCCAC 3′XbaI35 R325′ CGAACTCCTGGTAGGTGTCAAAGGC 3′34335′ GCCTTTGACACCTACCAGGAGTTCG 3′37 R345′ ACGCGGCCGCATCCAGACCTTNotICATCACTGAGGC 3′39 R355′ GCGGCCGCGGACTCATCAGAAGCCGCAG...

example 2

In Vivo Bioactivity Tests of hGH-CTP Polypeptides of the Present Invention

[0307]The following experiment was performed in order to test the potential long acting biological activity of hGH-CTP polypeptides in comparison with commercial recombinant human GH and MOD-4020.

Materials and Methods

[0308]Female hypophysectomized rats (60 -100 g) received a weekly S.C. injection of 21.7 μg hGH-CTP polypeptides or a once daily 5 μg S.C. injection of control commercial rhGH.

[0309]Weight was measured in all animals before treatment, 24 hours following first injection and then every other day until the end of the study on day 21. Each point represents the group's average weight gain percentage ((Weight day 0-weight last day) / Weight day 0). Average weight gain was normalized against once-daily injection of commercial hGH. The treatment schedule is summarized in Table 2.

TABLE 2EquimolarAccumulateTreatmentDoseDosageDoseNo.DrugNRouteSchedule(μg / rat)(μg / rat)Vol. (ml)1Vehicle7s.c.days 1, 7NANA0.25and 1...

example 3

Pharmacokinetic Studies of CTP-Modified GH

[0312]Single-dose pharmacokinetic studies were conducted in Sprague-Dawley rats. All animal experimentation was conducted in accordance with the Animal Welfare Act, the Guide for the Care and Use of Laboratory Animals, and under the supervision and approval of the Institutional Animal Care and Use Committees of Modigene, Biotechnology General Ltd. Rats were housed either individually or two per cage in rooms with a 12-h light / dark cycle. Access to water (municipal supply) and noncertified rodent chow was provided ad libitum.

[0313]To compare the pharmacokinetics of CTP-hGH-CTP-CTP and GH in rats, four groups of Sprague-Dawley rats (270-290 g), three to six male rats per group. The rats were randomly assigned to four treatment groups (see Table 3). Rats were administered a single s.c. or i.v. injection of GH (50 μg / kg i.v. or s.c.) or CTP-hGH-CTP-CTP (108 μg / kg i.v. or s.c.). With the exception of the predose sample, which was collected under ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
pHaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to view more

Abstract

CTP-modified human growth hormone polypeptides and pharmaceutical formulations and pharmaceutical compositions comprising the same and methods of producing, and using the same are disclosed.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application is a continuation application of PCT / IL2014 / 050910, filed Oct. 21, 2014, which claims the benefit of U.S. Provisional patent application Ser. No. 14 / 059,134, filed on Oct. 21, 2013 and U.S. Provisional patent application Ser. No. 14 / 309,496, filed Jun. 19, 2014, all of which are incorporated by reference herein in their entirety.FIELD OF INVENTION[0002]CTP-modified human growth hormone polypeptides and pharmaceutical formulations and pharmaceutical compositions comprising the same and methods of producing, and using the same are disclosed.BACKGROUND OF THE INVENTION[0003]Polypeptides are susceptible to denaturation or enzymatic degradation in the blood, liver or kidney. Accordingly, polypeptides typically have short circulatory half-lives of several hours. Because of their low stability, peptide drugs are usually delivered in a sustained frequency so as to maintain an effective plasma concentration of the active peptide. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): C07K14/61A61K38/24A61K38/27C07K14/59
CPCC07K14/61C07K14/59C07K2319/31A61K38/27A61K38/24C07K14/505C07K14/555C07K2319/00A61K47/02A61K47/12G01N33/74G01N2333/65G01N2800/52
Inventor FARES, FUADFIMA, UDI EYAL
Owner OPKO BIOLOGICS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap