Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer for detecting E. coli 0157:H7 nucleotide segment and probe sequence

A technology for Escherichia coli and nucleotides, applied in the field of primers and probe sequences for detecting Escherichia coli 0157:H7 nucleotide fragments, can solve the problems of PCR product contamination, difficult to control false positive rate and false negative rate, and immature technology And other issues

Inactive Publication Date: 2008-06-18
TAITAI GENOMICS
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The gene chip method has high detection efficiency, but the technology is immature, the false positive rate and false negative rate are difficult to control, and the cost is high, and it is still in the research stage
Ordinary PCR method is mature in technology and was first used in the detection of food-borne pathogenic bacteria. However, post-processing of PCR products is required, which can easily lead to PCR product contamination, and also has certain non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting E. coli 0157:H7 nucleotide segment and probe sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] 1. Design of primers and probes: Through comparative analysis of all known Escherichia coli 0157:H7 genome sequences, select a highly conserved segment without secondary structure (Escherichia coli 0157:H7 rfbE gene), and design multiple pairs For primers and probes, the length of the primers is generally about 20 bases, and there is no complementary sequence between and within the primers. The optimal primer and probe combination sequences are as follows:

[0012] Upstream primer 0157RFBEF: TCCTCAGCTATAGGGTGCTTTTG

[0013] Downstream primer 0157RFBER: ATCGAAACAAGGCCAGTTTTTAC

[0014] Probe 0157RFBE-p1: TTTCCGAGTACATTGGC

[0015] 2. Establishment and optimization of the reaction system: The target region template used in the establishment and optimization of the reaction system was obtained by the following method: take Escherichia coli 0157:H7 standard strain and culture it for 48 hours after recovery, take 1ml of the culture solution for 10-fold serial dilution , s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is primer and probe sequence for detecting nucleotide segment of E. coli O157: H7. The primer sequence includes the primer pair comprising upstream primer sequence O157RFBEF of TCCTCAGCTATAGGGTGCTTTTG and downstream primer sequence O157RFBER of ATCGAAACAAGGCCAGTTTTTTAC, as well as 10 bases extending in 5' end direction of upstream primer O157RFBEF and 10 bases extending in 3' end direction and 10 bases extending in 5' end direction of downstream primer O157RFBER. The probe sequence includes probe O157RFBE-p1 sequence TTTCCGAGTACATTGGC, 10 bases extending in the 3' end direction and 4 bases extending in the 5' end direction.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting 0157:H7 nucleotide fragments of Escherichia coli. Background technique [0002] Escherichia coli 0157:H7 is a common pathogenic bacterium in imported and exported food, and it is also the main pathogenic bacterium that causes food poisoning and foodborne diseases. The bacterium can produce bacterial toxins like common pathogenic bacteria, causing a series of symptoms such as diarrhea in the infected person, and may cause the more serious hemolytic uremic syndrome. Foods such as beef, milk, beef or milk products, chicken, pork, mutton, vegetables, fruits, beverages, salads, and water may become its infectious agents. In 2002, Order No. 25 and No. 26 of the General Administration of Quality Supervision, Inspection and Quarantine clearly stipulated that Escherichia coli 0157:H7 was a mandatory inspection item. At present, national standards and industry standards mostly adopt tradition...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 肖性龙林镜中
Owner TAITAI GENOMICS