Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of general fluorescence labeling probe on PCR-LDR gene mononucleotide polymorphism chip

A single nucleotide polymorphism, labeling probe technology, applied in the biological field, can solve the problems of inconvenient development and application, expensive probe cost, etc.

Inactive Publication Date: 2009-02-04
上海翼和应用生物技术有限公司
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there have been the associated use of LDR technology and PCR technology, and the association of LDR technology, PCR technology and gene chip technology for gene single nucleotide polymorphism site detection (Norman P.Gerry 1 et al., J.Mol .Biol.(1999) 292,251-262, U.S.Pat.Pub.No.2003 / 0032016A1), the emergence of these technologies greatly facilitates the detection of gene loci, but in these technologies, a large number of fluorescently labeled probes are required. needles, and these labeled probes are expensive, causing inconvenience to development and application, thus limiting their application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of general fluorescence labeling probe on PCR-LDR gene mononucleotide polymorphism chip
  • Application of general fluorescence labeling probe on PCR-LDR gene mononucleotide polymorphism chip
  • Application of general fluorescence labeling probe on PCR-LDR gene mononucleotide polymorphism chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Design of Probes

[0037] Taking the 1896 site of hepatitis B virus (HBV) DNA as an example, the sequence near the 1896 site is:

[0038] 5'GCTGTGCCTTGGGTGGCTTTG / AGGGCATGGACATTGACCCG3'

[0039] 1. Primer and Probe Design

[0040] (1) Primer design

[0041] Primer sequence (5'→3')

Length (nt)

upstream primer

CACCTCTGCCTTCATCTCATGTTCATGT

30

downstream primer

ACACAGAATAGCTTGCCTGAGTGCTGTATG

30

[0042] (2) Universal labeled probe: Cy5-GATGTAATCCTCCGTAGTGTCGCA

[0043] (3) Labeled probe

[0044] probe name

Probe sequence (5'→3')

Length (nt)

and template pairing

Divided into

AAAGCCACCCAAGGCACAGC

24

with PCR primers

to part

TGCGACACTACGGAGGATTACATC

24

total probe sequence *

AAAGCCACCCAAGGCACAGCTGCGACACTAC

GGAGGATTACATC

48

[0045] Note: * Indicates that the probe needs to be phosph...

Embodiment 2

[0056] Example 2: Detection of DNA polymorphisms with single point mutations

[0057] Take the HBV1896 site as an example to detect the single site DNA polymorphism.

[0058] 1. Primer and Probe Design

[0059] (1) General PCR primer design

[0060] HBV1896 primer sequence (5'→3')

upstream primer

CACCTCTGCCTAATCATCTCATGTTCATGT

downstream primer

ACACAGAATAGCTTGCCTGAGTGCTGTATG

HBVYIDD / YMDD primer sequence (5'→3')

upstream primer

CAAGGTATGTTGCCCGTTTGTCC

downstream primer

GG(CT)A(AT)AAAGGGACTCA(AC)GATG

[0061] (2) Universal labeled probe: Cy5-GATGTAATCCTCCGTAGTGTCGCA

[0062] (3) Labeled probe

[0063] probe name

HBV1896(G / A) labeled probe sequence (5'→3')

Match with template

to part

AAAGCCACCCAAGGCACAGC

and tagging

Needle pair

Minute

TGCGACACTACGGAGGATTACATC

Probe sequence

List *

AAAGCCACCCAAGGCACAGCTGCGACACTACGGAGGATTACA...

Embodiment 3

[0076] Example 3: Detection of Cardiovascular Disease-Related Gene Polymorphisms

[0077] The SNPs of cardiovascular related genes (ACE, AGT, ANP664, ALDH, APOE112 and APOE158) were typed.

[0078] 1. Primer and Probe Design

[0079] (1) General PCR primer design

[0080] ACE primer sequence (5'→3')

upstream primer

GCCCTGCAGGTGTCTGCAGCATGT

downstream primer

GGATGGCCTCTCCCCGCCTTGTCTC

APOE (including 112, 158 two sites) primer sequence (5'→3')

upstream primer

AGGGtGCTGATGGACGAGACCATGAAGGAG

[0081] downstream primer

GCTCaCGGATGGCGCTGAGGCCGCGCTCGG

AGT primer sequence (5'→3')

upstream primer

GACGTAGGTGTTGAAAGCCAGGGTGCTGTC

downstream primer

TATACCCCTGTGGTCCTCCCACGCTCTCTG

ALGH primer sequence (5'→3')

upstream primer

CAGTCACCCCTTTGGTGGCTACAAGATG

downstream primer

CTGGGTCTTTACCTCTCTCTTGTCACTTCTC

ANP664 primer sequence (5'→3')

upstream ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a general fluorescence labeling probe on a PCR-LDR gene SNP single nucleotide polymorphism chip. The application of the invention comprises the steps which are probe design, PCR product preparation, LDR product preparation and result detection, etc. The probe of the invention comprises a labeling probe and a testing probe, because the labeling probe is modified and the chemical labeling does not need to be directly carried out, the technical cost of the PCR-LDR combined chips can be reduced and the synthesis time of the probes can be saved, and the testing results reach the accuracy and the precision tested by the direct labeling technology.

Description

Technical field: [0001] The invention relates to biotechnology, in particular to the application of a universal fluorescent label probe on a PCR-LDR gene single nucleotide polymorphism (Single Nucleotide Polymorphisms, abbreviated as SNP) chip. Background technique [0002] With the development of human pharmacogenomics, more and more research results will be applied to clinical diagnosis, which requires a large-scale detection method for gene single nucleotide polymorphism sites. In recent years, the ligation reaction is used to detect gene single nucleotide polymorphism sites more and more people's attention, scholars have done a lot of research (France Barany et al., Proc.Nat'l Acad.Sci. USA, 88: 189-93 (1991), The Ligase Chain Reaction (LCR) in a PCR World, PCR Methods and Applications, 1: 5-16 (1991)). Ligase chain reaction (ligase chain reaction, LCR) refers to the design of two pairs of probes in the reaction, so that the ligation reaction can exponentially amplify t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 肖君华陆炯陈轶群
Owner 上海翼和应用生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com