Use of carbonyl reductase in (S)-4-chloro-3 hydroxy butyric ether production

A technology of ethyl hydroxybutyrate and carbonyl reductase, which is applied in the direction of oxidoreductase, fermentation, etc., to achieve the effects of high yield, low production cost and high optical activity

Inactive Publication Date: 2009-02-25
NANJING UNIV OF TECH
View PDF0 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no report has been found that this carbonyl reductase is used for the asymmetric reduction of COBE to prepare (S)-CHBE

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of carbonyl reductase in (S)-4-chloro-3 hydroxy butyric ether production
  • Use of carbonyl reductase in (S)-4-chloro-3 hydroxy butyric ether production
  • Use of carbonyl reductase in (S)-4-chloro-3 hydroxy butyric ether production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of recombinant Escherichia coli E.coli Rosseta (pET22b-PsCR)

[0027] 1. Acquisition of carbonyl reductase gene

[0028] Pichia Stipitis CBS 6054 (purchased from Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversiry Centre), medium YPD (g L -1 ): Yeast extract 10g, peptone 20g, glucose 20g, add distilled water to 1L.

[0029] Pichia Stipitis CBS 6054 was inoculated in 5mL LYPD liquid medium and cultured at 30°C to logarithmic growth phase, and the genome was extracted using a genomic DNA extraction kit (Beijing Tianwei Bioengineering Co., Ltd. Yeast Genome Extraction Kit).

[0030] The primers used to construct the expression vectors are provided with enzyme cutting sites, and the primer sequences are as follows:

[0031] The upstream primer (CR-sense contains Nde I) is: 5'GGAATTC CATATG ACCAACAACCCGAGCAT downstream primer (CR-anti containing BamH I) is: CGC GGATCC CTATGGCGCACAGTAGCCTCC

[0032] All primers were synthesized by Sha...

Embodiment 2

[0041] Embodiment 2: Fermentation of recombinant Escherichia coli E.coli Rosseta (pET22b-PsCR)

[0042] Pick the recombinant bacteria E.coli Rosseta (pET-22b-PsCR) into the LB culture medium containing antibiotics, and cultivate overnight at 37°C with shaking. Then inoculate into fresh culture medium according to 2% inoculum amount, and cultivate to OD at 37°C 600 At about 0.6, add IPTG to a final concentration of 0.8mmol·L -1 , 25°C, 220rpm, after induction of expression for 10h, centrifuge at 8000rpm, 4°C for 10min, discard the supernatant, and precipitate for later use.

Embodiment 3

[0044] The precipitate of Example 2 was washed twice with potassium phosphate buffer (100mmol·L-1, pH 6.5), weighed 0.5g (wet weight) of E. coli sludge, and suspended in 15mL of pH 6.5 potassium phosphate buffer. Cells were sonicated (power 300W, sonication 5s, intermittent 5s, 5min in total), glucose 200mmol / L, COBE 1.5g / L, GDH 50U, NADP 0.05mmol / L, 20°C, 180rpm, 16h. The yield of the product (S)-CHBE was 1.45 g / L, the yield of the product was: 96.7%, and the optical purity e.e% was 100%.

[0045] The detection method of product is as follows (the detection method of product is identical with embodiment 3 in the following examples):

[0046] For the aqueous phase reaction: after the reaction, add an equal volume of ethyl acetate, vibrate vigorously for 10 minutes, then place it for two hours, and centrifuge at 8000rpm for 10 minutes to separate the organic layer and the aqueous layer. Carefully draw the upper layer of ethyl acetate through the organic membrane, add the inter...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of carbonyl reductase with the amino acid sequence as shown in SEQ ID NO:2 to prepare (S)-4-chloro-3-hydroxybutanoic ethyl ester by asymmetric reduction of 4-chloracetyl ethyl acetate. The carbonyl reductase with the amino acid sequence as shown in SEQ ID NO:2 is taken as a catalyst, the ethyl 4-chloracetyl ethyl acetate is taken as a substrate, and NADPH is taken as a cofactor, and the (S)-4-chloro-3-hydroxybutanoic ethyl ester is prepared by the asymmetric reduction. The carbonyl reductase with the amino acid sequence as shown in SEQ ID NO:2 is applied to preparing the (S)-4-chloro-3-hydroxybutanoic ethyl ester by the asymmertric reduction of the 4-chloroacetyl ethyl acetate for the first time, which produces good effect; the yield of the substrate is up to 95%, and the enantiomer excess value of the product is 100%, the yield is high, and the production cost is greatly reduced.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of a carbonyl reductase, in particular to a carbonyl reductase (Ccarbonyl Rreductase CR) used in the asymmetric reduction reaction of ethyl 4-chloroacetoacetate to produce (S) - Application of ethyl 4-chloro-3-hydroxybutyrate. Background technique [0002] (S)-4-chloro-3-hydroxybutanoate (Ethyl 4-chloro-3-hydroxybutanoate, (S)-CHBE) is an important organic intermediate, which can be used in the synthesis of many active drugs, such as statins Drugs - hydroxymethylglutaryl CoA (HMG-CoA) reductase inhibitors and 4-hydroxypyrrolidone (4-hydroxypyrrolidone), etc. [1]. [0003] 4-chloroacetoacetate ethyl COBE (4-chloroacetoacetate Ethyl COBE) is used as the hypochiral substrate of the reduction reaction, which is easy to synthesize and low in price. It is very economical to use it as a substrate for asymmetric reduction reaction to obtain (S)-CHBE efficient way of preparati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P7/62C12N9/02
CPCC12N9/0004C12P7/42
Inventor应汉杰严明叶齐许琳熊健柏建新陈勇李振江
OwnerNANJING UNIV OF TECH