Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing recombinant porcine alpha interferon standard substance

A technology of alpha interferon and interferon, which is applied in the field of preparation of recombinant porcine alpha interferon standard product

Active Publication Date: 2010-06-16
ANHUI JIUCHUAN BIOTECH +1
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no standard product of rpoIFN-α at home and abroad, which brings a lot of inconvenience to the actual research work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing recombinant porcine alpha interferon standard substance
  • Method for preparing recombinant porcine alpha interferon standard substance
  • Method for preparing recombinant porcine alpha interferon standard substance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0054] The preparation method of recombinant porcine interferon alpha standard substance:

[0055] 1. Fermentation and protein extraction of recombinant porcine α-interferon engineering bacteria:

[0056] Recombinant porcine α-interferon engineering strains were cultivated overnight at 37°C on solid LB medium containing ampicillin;

[0057] The expression plasmid of recombinant porcine α-interferon engineering bacteria is pET-32(a), and the porcine α-interferon gene is loaded; the genetic engineering host bacterium is E. coli BL21 (DE3); the sequence is:

[0058] TGAAAGTGAAAAGAAGCATGACGGCAAGTGGACGATTGGAATTCATGTGTGACCTGCCTCAGACCCACAGCCTGGCTCACACCAGGGCCCTGAGGCTCCTGGCACAAATGAGGAGAATCTCTCCCTTCTCCTGCCTGGACCACAGAAGGGACTTTGGATCCCCTCATGAGGCTTTTGGGGGCAACCAGGTCCAGAAGGCTCAAGCCATGGCTCTGGTGCATGAGATGCTCCAGCAGACCTTCCAGCTCTTCAGCACAGAGGGCTCGGCTGCTGCCTGGGATGAGAGCCTCCTGCACCAGTTCTGCACTGGACTGGATCAGCAGCTCAGGGACCTGGAAGCCTGTGTCATGCAGGAGGCGGGGCTGGAAGGGACGCCCCTGCTGGAGGAGGACTCCATCCTGGCTGTGAGGAAATACTTCCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a recombinant porcine alpha interferon (rpoIFN-alpha) standard substance, which comprises the following steps of: performing fermentation, induction expression and total protein extraction on the recombinant strain of the recombinant porcine alpha interferon and obtaining the standard substance through two-step purification. The rpoIFN-alpha biologic activity reference standard substance prepared by the method can be applied to characteristic identification and potency assay of the rpoIFN-alpha so as to make the potency results of the rpoIFN-alpha measured in different batches or in the same batch but different times more credible by taking the standard substance as a standard.

Description

technical field [0001] The invention relates to a preparation method of a standard product, in particular to a preparation method of a recombinant porcine alpha interferon standard product. Background technique [0002] Animal husbandry is one of the important pillar industries of my country's national economy, and the breeding method has developed rapidly from traditional extensive management to high-density and intensive farming. However, with the rapid development of high-density and intensive farming, viral diseases have become the first major obstacle restricting the rapid development of the livestock and poultry industry. According to incomplete statistics, the mortality rate of livestock and poultry caused by various viral diseases in my country is as high as 15%-20% every year, and the economic loss reaches billions of yuan. At the same time, after my country's accession to the WTO, the market demand for livestock and poultry products has gradually shifted from quan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P21/02C07K14/56C07K1/22C07K1/16G01N33/68C12R1/19
Inventor 王明丽赵俊
Owner ANHUI JIUCHUAN BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com