Unlock instant, AI-driven research and patent intelligence for your innovation.

Ribonucleic acid taking liver cancer related gene DLK1 as target spot and application thereof

A ribonucleic acid and gene technology, applied in the fields of molecular biology and genetic engineering, can solve the problems of little knowledge and poor prognosis of liver cancer

Inactive Publication Date: 2010-08-25
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Liver cancer is known as the "national disease" in my country. After half a century of exploration, although there is a certain understanding of the early diagnosis and treatment of liver cancer, the prognosis of liver cancer is still very poor, especially the understanding of its pathogenesis and treatment. Even less is known about new targets for drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ribonucleic acid taking liver cancer related gene DLK1 as target spot and application thereof
  • Ribonucleic acid taking liver cancer related gene DLK1 as target spot and application thereof
  • Ribonucleic acid taking liver cancer related gene DLK1 as target spot and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1 constructs and identifies the RNAi plasmid of DLK1

[0024] In this example, the pSUPER plasmid was introduced to construct an RNAi plasmid capable of relatively stable transfection of cells. The plasmid contains the H1-RNA polymerase III gene promoter, the cDNA sequence oligonucleotide that can transcribe the short-chain hairpin structure RNA (shRNA) is inserted into the promoter of the pSUPER plasmid, and the vector is transfected into the cell Afterwards, shRNA with a hairpin-like structure can be stably synthesized in the cell, that is, a relatively stable effect of silencing the target gene can be achieved.

[0025] The oligonucleotide sequences used in this example are as follows:

[0026] 1. pSUPER Luc+:

[0027] Forward primer: gatccccctt acgctgagta cttcgattca agagatcgaagtactcagcg taagtttttg gaaa

[0028] Reverse primer: agcttttcca aaaacttacg ctgagtactt cgatctcttgaatcgaagta ctcagcgtaa gggg

[0029] 2. pSUPER DLK874:

[0030] Forward primer: gat...

Embodiment 2

[0045] Example 2 Instantaneous clone formation test (proving that the clone formation ability of HCC cells is reduced after the expression of DLK1 is inhibited)

[0046] On the basis of identifying that the RNAi mediated by the pSUPER vector is effective, the three kinds of endogenously expressing DLK1 cells in Example 1 were subjected to a transient clone formation test (see Fig. 2, Fig. 3 ), and no endogenous DLK1 expression HCC cell line Bel-7402 cells were used as control cells.

[0047] The pSUPER empty plasmid, pSUPER DLK874, pSUPER DLK1011 plasmid and pcDNA3.0 plasmid were co-transfected into Hep3B, HepG2, Huh-7 and Bel-7402 cells at a ratio of 10 to 1, where the pcDNA3.0 plasmid was transfected The latter cells provide G418 resistance. After transfection, an equal amount of cells from each control group were divided into 100mm cell culture dishes for culture, and were screened with MEM or DMEM complete culture medium containing appropriate concentration of G418 and wa...

Embodiment 3

[0049] Example 3 Western Blotting analysis (proving that the growth and proliferation ability of Huh-7 cells is reduced after the expression of DLK1 is inhibited)

[0050] Taking Huh-7 cells as the object, pSUPER empty plasmid, pSUPER DLK874, pSUPERDLK1011 plasmid and pcDNA3.0 plasmid were co-transfected into Huh-7 cells at a ratio of 10 to 1, respectively, to construct Huh-7 stable cells that inhibited the expression of DLK1 strains, and Western Blotting Analysis was used to identify the expression of DLK1 at the protein level in four of the stable cell strains (see Figure 4).

[0051] In Figure 4, pSUPER C5 is a pSUPER empty plasmid stable cell line; p1011B3 and p1011A4 are subclones formed after stably transfected with pSUPER DLK1011; p874C2 is a subclone formed after stably transfected with pSUPER DLK874. Two cell lines Huh-7p874C2 and Huh-7p1011A4 with stable down-regulation of DLK1 were obtained, while the expression of DLK1 in the stable strain Huh-7p1011B3 was not down...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses ribonucleic acid taking a liver cancer related gene DLK1 as a target spot, which has the following oligonucleotide sequences: siRNA:S:GAGCUACGAGUGUCUGUGCAAGCdTdT (SEQ IDNO:10); AS:GCUUGCACAGACACUCGUAGCUCdTdT (SEQ ID NO:11). In addition, the invention also discloses application of the ribonucleic acid taking the liver cancer related gene DLK1 as the target spot in preparing an RNA interference medicament for curing primary liver cancer.

Description

[0001] This application is a divisional application of the following patent application: the application number is 200610119409.0, the application date is December 11, 2006, and the invention name is "liver cancer-related gene DLK1 and its application". technical field [0002] The present invention relates to the fields of molecular biology and genetic engineering, specifically, the present invention relates to liver cancer-related gene DLK1, a group of siRNAs targeting its mRNA sequence, and its use in the preparation of reagents for diagnosing liver cancer and drugs for gene therapy of liver cancer application. Background technique [0003] At present, there are about 12 million patients with chronic hepatitis in my country, and about 300,000 people die of liver disease every year, 50% of which are primary liver cancer, accounting for about 45% of the death toll of liver cancer in the world. The vast majority are related to HBV and HCV infection. The incidence rate of li...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113A61K48/00A61P35/00A61P1/16
Inventor 韩泽广黄健
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI