Car-t construction method targeting liver cancer-associated antigen dlk1
A DLK1-CAR, single-chain antibody technology, applied in the field of CAR-T cell construction, can solve the problem of no clinical data publication, achieve the effect of reliable reference, improve tolerance, and improve sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1. Establishment, screening and identification of a hybridoma cell line stably secreting anti-DLK1 monoclonal antibody
[0052] Step 1. Preparation of recombinant human DLK1 protein (immune antigen)
[0053] The expression vector pcDNA3.1B-DLK1 was constructed by PCR technology. In order to be more conveniently applied to gene expression, this empty plasmid pcDNA3.1B was artificially transformed in our laboratory. The specific method is to delete the BGH sequence at the 5' end of the sequence and add the T7 promoter, Xho I, Not I, EcoRV and EcoR I restriction sites, and introduce three flag tags. The gene fragment encoding the human DLK1 secretory region sequence (DLK1 soluble region, 24-303aa) was amplified from the human genome. The kappa signal peptide sequence was added to the front, and the His 6 tag tag sequence was added to the rear to construct the insert fragment kappa sp-DLK1soluble reg- His 6 tag, identified correctly by sequence determination, was...
Embodiment 2
[0064] Example 2, Preparation of DLK1 single-chain antibody
[0065] 1. Extract hybridoma cell line RNA and reverse transcribe it into cDNA by reverse transcriptase
[0066] The hybridoma cell line was revived, and the RNA was extracted by the Trizol method; after quantification, 2 μg of RNA was taken and reverse-transcribed into cDNA under the action of reverse transcriptase (Takarg reverse transcription kit).
[0067] 2. Using the above cDNA as a template, the heavy chain variable region primer VH Mix and the light chain variable region primer VL Mix (amplification primers are from the kit provided by Novagen, the article number is 69831-3) were respectively under the action of DNApolymerase , to amplify the heavy chain and light chain variable region genes;
[0068] P1: heavy chain variable region gene sequence VH:
[0069]CAGGTCCAGCTGCAGCAGTCTGGCGCTGAGTTGGTGAAACCTGGAGCTTCAATGAAGATATCCTGCGAGGTTTCTGGCTACACCTTCACTGACCATACTCTTCACTGGATGAAACAGAGGCCTGAACAGGGCCTGGAATGGATTGGATA...
Embodiment 3
[0089] Example 3, DLK1 CAR vector construction and lentiviral supernatant production
[0090] 1. Construction of DLK1 CAR vector
[0091] 1.1 Vector linearization: the CAR protein expression vector is linearized after single digestion with BamH I;
[0092] 1.2 According to the principle of homologous recombination, PCR primers were designed, and the scFv single-chain antibody gene was inserted into the CAR vector by seamless cloning to construct the DLK1 CAR vector;
[0093] PCR primer sequences:
[0094] P3: DLK1-scFv-F: TCCACGCCGCCAGGCCGGCAGGTCCAGCTGCAGCAGTCT (SEQ ID NO: 3)
[0095] P4: DLK1-scFv-R: AGACCGGCACGAAGGATCGTTTGATTTCCAGCTTGGTGC (SEQ ID NO: 4)
[0096] 1.3 By seamless cloning, insert the DLK1 single-chain antibody sequence into the CAR expression vector, and verify the sequence is correct by sequencing. The schematic diagram of the inserted fragment of DLK1-CAR vector is as follows image 3 As shown, the DLK1 single chain antibody gene sequence is as follows ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


