Car-t construction method targeting liver cancer-associated antigen dlk1

A DLK1-CAR, single-chain antibody technology, applied in the field of CAR-T cell construction, can solve the problem of no clinical data publication, achieve the effect of reliable reference, improve tolerance, and improve sensitivity

Active Publication Date: 2021-02-12
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are also related research institutions in China that are carrying out relevant further clinical research, but no good clinical data have been released yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Car-t construction method targeting liver cancer-associated antigen dlk1
  • Car-t construction method targeting liver cancer-associated antigen dlk1
  • Car-t construction method targeting liver cancer-associated antigen dlk1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1. Establishment, screening and identification of a hybridoma cell line stably secreting anti-DLK1 monoclonal antibody

[0052] Step 1. Preparation of recombinant human DLK1 protein (immune antigen)

[0053] The expression vector pcDNA3.1B-DLK1 was constructed by PCR technology. In order to be more conveniently applied to gene expression, this empty plasmid pcDNA3.1B was artificially transformed in our laboratory. The specific method is to delete the BGH sequence at the 5' end of the sequence and add the T7 promoter, Xho I, Not I, EcoRV and EcoR I restriction sites, and introduce three flag tags. The gene fragment encoding the human DLK1 secretory region sequence (DLK1 soluble region, 24-303aa) was amplified from the human genome. The kappa signal peptide sequence was added to the front, and the His 6 tag tag sequence was added to the rear to construct the insert fragment kappa sp-DLK1soluble reg- His 6 tag, identified correctly by sequence determination, was...

Embodiment 2

[0064] Example 2, Preparation of DLK1 single-chain antibody

[0065] 1. Extract hybridoma cell line RNA and reverse transcribe it into cDNA by reverse transcriptase

[0066] The hybridoma cell line was revived, and the RNA was extracted by the Trizol method; after quantification, 2 μg of RNA was taken and reverse-transcribed into cDNA under the action of reverse transcriptase (Takarg reverse transcription kit).

[0067] 2. Using the above cDNA as a template, the heavy chain variable region primer VH Mix and the light chain variable region primer VL Mix (amplification primers are from the kit provided by Novagen, the article number is 69831-3) were respectively under the action of DNApolymerase , to amplify the heavy chain and light chain variable region genes;

[0068] P1: heavy chain variable region gene sequence VH:

[0069]CAGGTCCAGCTGCAGCAGTCTGGCGCTGAGTTGGTGAAACCTGGAGCTTCAATGAAGATATCCTGCGAGGTTTCTGGCTACACCTTCACTGACCATACTCTTCACTGGATGAAACAGAGGCCTGAACAGGGCCTGGAATGGATTGGATA...

Embodiment 3

[0089] Example 3, DLK1 CAR vector construction and lentiviral supernatant production

[0090] 1. Construction of DLK1 CAR vector

[0091] 1.1 Vector linearization: the CAR protein expression vector is linearized after single digestion with BamH I;

[0092] 1.2 According to the principle of homologous recombination, PCR primers were designed, and the scFv single-chain antibody gene was inserted into the CAR vector by seamless cloning to construct the DLK1 CAR vector;

[0093] PCR primer sequences:

[0094] P3: DLK1-scFv-F: TCCACGCCGCCAGGCCGGCAGGTCCAGCTGCAGCAGTCT (SEQ ID NO: 3)

[0095] P4: DLK1-scFv-R: AGACCGGCACGAAGGATCGTTTGATTTCCAGCTTGGTGC (SEQ ID NO: 4)

[0096] 1.3 By seamless cloning, insert the DLK1 single-chain antibody sequence into the CAR expression vector, and verify the sequence is correct by sequencing. The schematic diagram of the inserted fragment of DLK1-CAR vector is as follows image 3 As shown, the DLK1 single chain antibody gene sequence is as follows ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a CAR-T construction method targeting the liver cancer-associated antigen DLK1. In the present invention, the single-chain antibody of liver cancer-associated antigen DLK1 is recombined into T cells, and the T cells after genetic engineering are further activated, thereby enhancing the lethality of T cells to liver cancer cells; the single-chain antibody of DLK1 is secreted Obtain RNA from the hybridoma cell line of DLK1 monoclonal antibody, and obtain cDNA after reverse transcription; design PCR primers for the variable region of the heavy chain and the variable region of the light chain; obtained by amplification and splicing of chain variable regions. The detection method of the invention has relative sensitivity and specificity, and can reduce the side effects caused by T cells recognizing normal cells. The present invention provides a certain research basis for CAR-T cell immunotherapy in liver cancer immunotherapy.

Description

technical field [0001] The present invention relates to the field of emerging biotherapy technologies, in particular to a method for constructing CAR-T cells targeting the liver cancer-associated antigen DLK1. Background technique [0002] Primary liver cancer is one of the common malignant tumors, most of which are hepatocellular carcinoma (HCC), which ranks sixth in the incidence of malignant tumors and third in the mortality rate. In my country, the morbidity and mortality of liver cancer ranks second among cancers. Because of the lack of early preventive diagnosis and treatment measures, and because of its high degree of malignancy and rapid progression, currently, the treatment methods for hepatocellular carcinoma mainly focus on chemotherapy and surgical resection, and the curative effect is not obvious, especially for patients with advanced liver cancer. The survival period is only a few months. The occurrence and development of liver cancer is a multi-stage, multi-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/20C07K16/28C12N15/13C12N15/10C12N15/867C12N5/10A61K35/17A61P35/00
CPCA61K35/17C07K16/28C07K2317/622C12N5/0636C12N15/1096C12N15/86C12N2510/00C12N2740/15043C12N2800/107C12Q2531/113C12Q2525/191
Inventor 韩泽广翟杨杨
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products