Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing adenovirus core protein genetic marker vector

A core protein and genetic marker technology, applied in the direction of viruses/bacteriophages, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as low efficiency

Inactive Publication Date: 2012-01-11
SHAANXI NORMAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is to overcome the shortcoming that the above-mentioned fluorescent protein-labeled core protein is bound to the viral genomic DNA with low efficiency, and to provide a fast, fully capable construction of the adenovirus core protein genetic marker carrier method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing adenovirus core protein genetic marker vector
  • Method for constructing adenovirus core protein genetic marker vector
  • Method for constructing adenovirus core protein genetic marker vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Taking the construction process of the red fluorescent protein (mCherry)-marked core protein pVII adenoviral vector as an example, the construction method steps are as follows:

[0037] 1. Construction of a shuttle vector that introduces a single restriction site to the 3' end of the DNA sequence of the core protein of the adenovirus genome

[0038] The synthesized DNA sequence was ligated into the pUC19 plasmid vector by enzyme digestion and ligation. The pUC19 plasmid vector is a commercial product produced by NEB Company in the UK. A positive clone was obtained through plasmid extraction, enzyme digestion identification and sequencing, and the positive clone was named pUC19M , the carrier structure is as figure 1 shown by figure 1 It can be seen that the synthesized DNA sequence contains the following restriction sites: XbaI-BamHI-SfuI-XhoI-ClaI.

[0039] Using the adenovirus genome DNA as a template, two pairs of primers were designed to amplify the DNA sequence o...

Embodiment 2

[0059] Taking the construction process of the green fluorescent protein (eGFP)-labeled core protein pVII adenoviral vector as an example, the construction method steps are as follows:

[0060] 1. The 3' end of the core protein DNA sequence of the adenovirus genome introduces a shuttle vector with a single restriction site

[0061] Using the adenovirus genome DNA as a template, two pairs of primers were designed to amplify the 800 bp DNA sequence upstream and downstream of the core protein DNA sequence for homologous recombination, and the upstream DNA sequence contained the DNA sequence of the adenovirus core protein VII itself. P1-P4 are the sequences of two pairs of primers:

[0062] P1: ATCTAGACGCGCCCGCCAGCCCCCACCATCACCACCG

[0063] P2: TGGATCCACCTCCCACCTCCGTTGCGCGGGGGGCGGGTGCG

[0064] P3: ACTCGAGATTGCAAGAAAAAACTACTTAGACTC

[0065] P4: TATCGATGAGGCAACCGGGGACGTTTGTGTCTCC

[0066] The conditions of the polymerase chain reaction were: 94°C for 30 seconds, 98°C for 10 seco...

Embodiment 3

[0082] Taking the construction process of the luciferase luciferase-labeled core protein pVII adenoviral vector as an example, the steps of the construction method are as follows:

[0083] 1. Construction of a shuttle vector that introduces a single restriction site at the 3' end of the DNA sequence of the core protein of the adenovirus genome

[0084] Using the adenovirus genome DNA as a template, two pairs of primers were designed to amplify the 10kb DNA sequence upstream and downstream of the core protein DNA sequence used for homologous recombination, and the upstream DNA sequence contained the DNA sequence of the adenovirus core protein VII itself. P1-P4 are the sequences of two pairs of primers:

[0085] P1: ATCTAGAAAGGTCAACGCTGGTGGCTACCCTCTCCGCG

[0086] P2: TGGATCCACCTCCCACCTCCGTTGCGCGGGGGGCGGGTGCG

[0087] P3: ACTCGAGATTGCAAGAAAAAACTACTTAGACTC

[0088] P4: TATCGATTCGGCGAACGGGCAGTGCCGGCGGCGC

[0089] The conditions of the polymerase chain reaction were: 94°C for 30...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing an adenovirus core protein genetic marker vector, which comprises the following steps of: constructing a shuttle vector for introducing an enzyme cutting site to the 3' end of an adenovirus genome core protein DNA sequence, introducing an adenovirus skeleton vector of the enzyme cutting site, constructing a marker gene for marking the core proteinshuttle vector, constructing a marker gene for marking a core protein adenovirus plasmid vector, and packing and purifying marker gene marked core protein adenoviruses. The invention adopts a new method for marking the adenovirus core protein, the method realizes real genetic-level fluorescent mark of the adenovirus core protein, and the marking method deletes the original core protein gene in the adenovirus genome, so the method for marking the adenovirus core protein can obtain virus granules completely marked by the fluorescent protein.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for constructing an adenovirus core protein genetic marker carrier. Background technique [0002] Adenoviruses have three core proteins, pVII, pV, and mu. These core proteins are combined with the adenovirus genomic DNA, and after the adenovirus infects cells, the core protein will enter the nucleus along with the viral genomic DNA. Therefore, if the core protein of adenovirus is labeled with fluorescent protein, the whole process of virus infection of cells can be observed. [0003] Since there is no suitable restriction endonuclease site in the core protein gene region of the adenovirus genomic DNA, it is very difficult to successfully and thoroughly genetically mark the adenovirus core protein by means of homologous recombination. The current study reports that the method of marking the core protein is to insert the core protein-fluorescent protein gene expr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/65C12N15/861C12N7/00
Inventor 夏海滨赵俊丽
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com