Method for constructing adenovirus core protein genetic marker vector
A core protein and genetic marker technology, applied in the direction of viruses/bacteriophages, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as low efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Taking the construction process of the red fluorescent protein (mCherry)-marked core protein pVII adenoviral vector as an example, the construction method steps are as follows:
[0037] 1. Construction of a shuttle vector that introduces a single restriction site to the 3' end of the DNA sequence of the core protein of the adenovirus genome
[0038] The synthesized DNA sequence was ligated into the pUC19 plasmid vector by enzyme digestion and ligation. The pUC19 plasmid vector is a commercial product produced by NEB Company in the UK. A positive clone was obtained through plasmid extraction, enzyme digestion identification and sequencing, and the positive clone was named pUC19M , the carrier structure is as figure 1 shown by figure 1 It can be seen that the synthesized DNA sequence contains the following restriction sites: XbaI-BamHI-SfuI-XhoI-ClaI.
[0039] Using the adenovirus genome DNA as a template, two pairs of primers were designed to amplify the DNA sequence o...
Embodiment 2
[0059] Taking the construction process of the green fluorescent protein (eGFP)-labeled core protein pVII adenoviral vector as an example, the construction method steps are as follows:
[0060] 1. The 3' end of the core protein DNA sequence of the adenovirus genome introduces a shuttle vector with a single restriction site
[0061] Using the adenovirus genome DNA as a template, two pairs of primers were designed to amplify the 800 bp DNA sequence upstream and downstream of the core protein DNA sequence for homologous recombination, and the upstream DNA sequence contained the DNA sequence of the adenovirus core protein VII itself. P1-P4 are the sequences of two pairs of primers:
[0062] P1: ATCTAGACGCGCCCGCCAGCCCCCACCATCACCACCG
[0063] P2: TGGATCCACCTCCCACCTCCGTTGCGCGGGGGGCGGGTGCG
[0064] P3: ACTCGAGATTGCAAGAAAAAACTACTTAGACTC
[0065] P4: TATCGATGAGGCAACCGGGGACGTTTGTGTCTCC
[0066] The conditions of the polymerase chain reaction were: 94°C for 30 seconds, 98°C for 10 seco...
Embodiment 3
[0082] Taking the construction process of the luciferase luciferase-labeled core protein pVII adenoviral vector as an example, the steps of the construction method are as follows:
[0083] 1. Construction of a shuttle vector that introduces a single restriction site at the 3' end of the DNA sequence of the core protein of the adenovirus genome
[0084] Using the adenovirus genome DNA as a template, two pairs of primers were designed to amplify the 10kb DNA sequence upstream and downstream of the core protein DNA sequence used for homologous recombination, and the upstream DNA sequence contained the DNA sequence of the adenovirus core protein VII itself. P1-P4 are the sequences of two pairs of primers:
[0085] P1: ATCTAGAAAGGTCAACGCTGGTGGCTACCCTCTCCGCG
[0086] P2: TGGATCCACCTCCCACCTCCGTTGCGCGGGGGGCGGGTGCG
[0087] P3: ACTCGAGATTGCAAGAAAAAACTACTTAGACTC
[0088] P4: TATCGATTCGGCGAACGGGCAGTGCCGGCGGCGC
[0089] The conditions of the polymerase chain reaction were: 94°C for 30...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com