Microsatellite molecular marker of lycoris

A microsatellite marker, microsatellite technology, applied in DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of poor repeatability, inability to distinguish pure and heterozygous genotypes, etc.

Inactive Publication Date: 2011-03-23
ANHUI NORMAL UNIV
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the stability and repeatability of RAPD molecular markers are poor, and ISSR molecular markers are usually dominant markers, which cannot distinguish pure and heterozygous genotypes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microsatellite molecular marker of lycoris
  • Microsatellite molecular marker of lycoris
  • Microsatellite molecular marker of lycoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Construction of Lycoris microsatellite DNA enrichment library

[0026] 1.1 Genome extraction and digestion

[0027] Using the CTAB method introduced by Doyle J (Doyle J. DNA protocols for plants-CTAB total DNA isolation A.In Hewitt GM, Johnston [A] (eds.), Molecular Techniques in Taxonomy [M]. Berlin: Springer, 1991, 283 -293) extract Lycoris genome. The genome was digested with restriction endonuclease Sau3AI (purchased from TaKaRa Company). The digested product was electrophoresed on 1% agarose gel, and the 300bp-900bp DNA fragment was excised under ultraviolet light and purified and recovered with a gel extraction kit (purchased from Shanghai Sangong).

[0028] 1.2 Add connector:

[0029] Add the purified and recovered gel recovery product to the adapter:

[0030] LA(5'-GGCCAGAGACCCCCAAGCTTCG-3'),

[0031] LB(5'-P04-GATCCGAAGCTTGGGGTCTCTGGCC-3'),

[0032] Under the action of T4 ligase (purchased from Promega), the ligation was carried out overnight at 16°C i...

Embodiment 2

[0051] 2.1 Screen polymorphic primers:

[0052] Lycoris genome was extracted by CTAB method of 1.1. The genome was amplified with designed primers (Table 1). Reaction program: pre-denaturation at 94°C for 4 minutes, denaturation at 94°C for 45 seconds, annealing for 30 seconds (see Table 1 for annealing temperature), extension at 72°C for 35 seconds, and three steps from denaturation to annealing were repeated 35 times. A final full extension at 72°C for 8 minutes. 1.5% agarose gel electrophoresis detection. PCR products were detected by PAGE electrophoresis, and a total of 10 polymorphic microsatellite markers were obtained; Lyra-1 was 328 nucleotides, Lyra-2 was 469 nucleotides, Lyra-3 was 439 nucleotides, Lyra-4 is 538 nucleotides, Lyra-5 is 432 nucleotides, Lyra-6 is 422 nucleotides, Lyra-7 is 547 nucleotides, Lyra-8 is 400 nucleotides, Lyra-9 is 410 nucleotides and Lyra-10 is 416 nucleotides.

[0053] 2.2 Analysis of results:

[0054] The expected heterozygosity and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microsatellite deoxyribonucleic acid (DNA) molecular marker of lycoris. 33 microsatellite DNA-containing clones are obtained and 10 microsatellite molecular markers with rich polymorphism, namely Lyra-1, Lyra-2, Lyra-3, Lyra-4, Lyra-5, Lyra-6, Lyra-7, Lyra-8, Lyra-9 and Lyra-10, are determined by establishing a lycoris microsatellite (CT)n enrichment library, screening and sequencing the positive clones of the microsatellite. The marker can be used for researching genetic diversity protection of the lycoris and variation and evolution relation between species and populations of lycoris plants and identifying the varieties of the lycoris; and the marker has high repeatability and is a reliable and effective molecular marker.

Description

technical field [0001] The invention relates to molecular marker technology, in particular to a molecular genetic marker of Lycoris microsatellite. Background technique [0002] Microsatellite DNA is also called short tandem repeats (Short Tandem Repeats, STRs), simple sequence repeats (Simple Sequence Repeat, SSRs), simple sequence length polymorphism (SSLP). Refers to the nucleotide sequence composed of 1 to 6 nucleotides in series in the genome. . According to the composition of repeating units, microsatellite DNA sequences are divided into 3 types: single type, compound type (compound) and interrupted type (interrupted). For example: [0003] Single type: ATATATATATATATATATATATAT [0004] Composite type: ATATATCACACACACACACACAC [0005] Intermittent type: ATATATCA ATATATCA ATATATA [0006] As a molecular marker, microsatellite DNA has the following characteristics: it is widely distributed in the genome of eukaryotes, and it is estimated that there is one microsatel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11
Inventor朱国萍宣守芹王晖郑基阳高鹏李雪
OwnerANHUI NORMAL UNIV