Application of a kind of sorbose reductase in biological preparation of ethyl (s)-4-chloro-3-hydroxybutyrate

A technology of ethyl hydroxybutyrate and ethyl chloroacetoacetate is applied in the field of sorbose reductase to achieve the effects of reducing production cost, high yield and high optical activity

Inactive Publication Date: 2011-12-21
NANJING UNIV OF TECH
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no report has been found that this sorbose reductase is used for the asymmetric reduction of COBE to prepare (S)-CHBE

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a kind of sorbose reductase in biological preparation of ethyl (s)-4-chloro-3-hydroxybutyrate
  • Application of a kind of sorbose reductase in biological preparation of ethyl (s)-4-chloro-3-hydroxybutyrate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Step 1. Acquisition of sorbose reductase gene

[0031] Candida albicans Candida albicans (purchased from Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversiry Centre), medium YPD (g·L -1 ): Yeast extract 10g, peptone 20g, glucose 20g, add distilled water to 1L.

[0032] Candida albicans Candida albicans Inoculate in 5mL LYPD liquid medium and culture at 30°C until the logarithmic growth phase, and use the genomic DNA extraction kit (Beijing Tianwei Bioengineering Co., Ltd. Yeast Genome Extraction Kit) to extract the genome.

[0033] The primers used to construct the expression vectors are provided with enzyme cutting sites, and the primer sequences are as follows:

[0034] The upstream primer (SOU1-sense containing NdeI) is: 5'- GGAATTCCATATGATGAGTGAAGAAATTCATTTCA -3'

[0035] The downstream primer (SOU1-anti containing EcoRI) is: 5'- CCGGAATTCTTATGGACATGTATAACCCCCAT -3'

[0036] All primers were synthesized by Meiji Biotechnology Co., Ltd.

[0037] Gen...

Embodiment 2

[0059] As in Step 1 to Step 4 of Example 1, the precipitate was prepared for subsequent use. The above precipitate was washed twice with potassium phosphate buffer (100 mmol L-1, pH 6.5), and 0.5 g (wet weight) of E. coli sludge was weighed. Suspend in 25 mL of the total reaction solution (pH 6.5 potassium phosphate buffer to butyl acetate volume ratio of 1:1). Add mannitol 1300mmol / L, COBE 200g / L, 30°C, 180rpm, 16h. The yield of the product (S)-CHBE was 185g / L, the yield of the product was 92.5%, and the optical purity e.e% was 100%.

[0060] The detection method of product is with embodiment 1

Embodiment 3

[0062] As in Step 1 to Step 4 of Example 1, the precipitate was prepared for subsequent use. The above precipitate was washed twice with potassium phosphate buffer (100 mmol L-1, pH 6.5), and 0.5 g (wet weight) of E. coli sludge was weighed. Suspend in 25 mL of the total reaction solution (pH 6.5 potassium phosphate buffer to butyl acetate volume ratio of 1:1). Add xylitol 1300mmol / L, COBE 200g / L, 30°C, 180rpm, 16h. The yield of the product (S)-CHBE was 130 g / L, the yield of the product was 65%, and the optical purity e.e% was 100%.

[0063] The detection method of product is with embodiment 1.

[0064] Sequence List

[0065]

[0066]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of sorbose reductase in preparation of (S)-4-chloro-3-hydroxyethyl butyrate by a biological method. Sorbose reductase of which the amino acid sequence is disclosed as SEQ ID NO:2 is used as a catalyst, 4-chloracetylethyl acetate is used as a substrate, and NADPH (nicotinamide adenine dinucleotide phosphate) is used a cofactor to prepare the (S)-4-chloro-3-hydroxyethyl butyrate in an asymmetric reduction mode. In the invention, the sorbose reductase of which the amino acid sequence is disclosed as SEQ ID NO:2 is applied to preparation of (S)-4-chloro-3-hydroxyethyl butyrate in an asymmetric reduction mode for the first time, which has a good effect. The enzyme activity of the sorbose reductase is up to 5.6U / mg, the yield for substrate is up to 90%, and the enantiomeric excess of the product is 100%. Besides, the invention has the advantage of high yield, and greatly lowers the production cost.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a sorbose reductase, in particular to the application of the sorbose reductase in the production of (S)-4-chloro-3-hydroxybutyrate ethyl by biological methods. Background technique [0002] (S)-4-chloro-3-hydroxybutanoate (Ethyl 4-chloro-3-hydroxybutanoate, (S)-CHBE) is an important organic intermediate that can be used in the synthesis of many active drugs, such as statins Drugs - hydroxymethylglutaryl CoA (HMG-CoA) reductase inhibitors and 4-hydroxypyrrolidone (4-hydroxypyrrolidone), etc. [1]. [0003] 4-chloroacetoacetate ethyl COBE (4-chloroacetoacetate Ethyl COBE) is used as the hypochiral substrate of the reduction reaction, which is easy to synthesize and low in price. It is very economical to use it as a substrate for asymmetric reduction reaction to obtain (S)-CHBE efficient way of preparation. [0004] So far, there have been many research reports on the preparation of chira...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P7/62C12R1/19
Inventor严明郝宁安明东许晟蔡萍许琳李艳欧阳平凯
OwnerNANJING UNIV OF TECH